Change search
CiteExportLink to record
Permanent link

Direct link
Citation style
  • apa
  • ieee
  • modern-language-association-8th-edition
  • vancouver
  • Other style
More styles
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf
Pattern preferences of DNA nucleotide motifs by polyamines putrescine(2+), spermidine(3+)and spermine(4+)
Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Nanjing Tech University, China; Petru Poni Institute of Macromolecular Chemistry, Romania.ORCID iD: 0000-0001-9783-4535
Number of Authors: 42019 (English)In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 47, no 12, p. 6084-6097Article in journal (Refereed) Published
Abstract [en]

The interactions of natural polyamines (putrescine(2+), spermidine(3+)and spermine(4+)) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine(2+), spermidine(3+)and spermine(4+) in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Place, publisher, year, edition, pages
2019. Vol. 47, no 12, p. 6084-6097
National Category
Chemical Sciences
URN: urn:nbn:se:su:diva-171755DOI: 10.1093/nar/gkz434ISI: 000475891900012PubMedID: 31114917OAI:, id: diva2:1348530
Available from: 2019-09-04 Created: 2019-09-04 Last updated: 2019-12-09Bibliographically approved

Open Access in DiVA

No full text in DiVA

Other links

Publisher's full textPubMed

Search in DiVA

By author/editor
Perepelytsya, SergiyLaaksonen, Aatto
By organisation
Department of Materials and Environmental Chemistry (MMK)
In the same journal
Nucleic Acids Research
Chemical Sciences

Search outside of DiVA

GoogleGoogle Scholar


Altmetric score

Total: 1 hits
CiteExportLink to record
Permanent link

Direct link
Citation style
  • apa
  • ieee
  • modern-language-association-8th-edition
  • vancouver
  • Other style
More styles
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf