Change search
Refine search result
12 1 - 50 of 63
CiteExportLink to result list
Permanent link
Citation style
  • apa
  • ieee
  • modern-language-association-8th-edition
  • vancouver
  • Other style
More styles
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf
Rows per page
  • 5
  • 10
  • 20
  • 50
  • 100
  • 250
  • Standard (Relevance)
  • Author A-Ö
  • Author Ö-A
  • Title A-Ö
  • Title Ö-A
  • Publication type A-Ö
  • Publication type Ö-A
  • Issued (Oldest first)
  • Issued (Newest first)
  • Created (Oldest first)
  • Created (Newest first)
  • Last updated (Oldest first)
  • Last updated (Newest first)
  • Disputation date (earliest first)
  • Disputation date (latest first)
  • Standard (Relevance)
  • Author A-Ö
  • Author Ö-A
  • Title A-Ö
  • Title Ö-A
  • Publication type A-Ö
  • Publication type Ö-A
  • Issued (Oldest first)
  • Issued (Newest first)
  • Created (Oldest first)
  • Created (Newest first)
  • Last updated (Oldest first)
  • Last updated (Newest first)
  • Disputation date (earliest first)
  • Disputation date (latest first)
The maximal number of hits you can export is 250. When you want to export more records please use the Create feeds function.
  • 1.
    Ahlgren-Berg, Alexandra
    et al.
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Henriksson-Peltola, Petri
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Sehlén, Wilhelmina
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Haggård-Ljungquist, Elisabeth
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    A comparison of the DNA binding and bending capacities and the oligomeric states of the immunity repressors of heteroimmune coliphages P2 and W Phi2007In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 35, no 10, p. 3167-3180Article in journal (Refereed)
    Abstract [en]

    Bacteriophages P2 and W Phi are heteroimmune members of the P2-like family of temperate Escherichia coli phages. Temperate phages can grow lytically or form lysogeny after infection. A transcriptional switch that contains two convergent promoters, Pe and Pc, and two repressors regulate what life mode to enter. The immunity repressor C is the first gene of the lysogenic operon, and it blocks the early Pe promoter. In this work, some characteristics of the C proteins of P2 and W Phi are compared. An in vivo genetic analysis shows that W Phi C, like P2C, has a strong dimerization activity in the absence of its DNA target. Both C proteins recognize two directly repeated sequences, termed half-sites and a strong bending is induced in the respective DNA target upon binding. P2C is unable to bind to one half-site as opposed to W Phi, but both half-sites are required for repression of W Phi Pe. A reduction from three to two helical turns between the centers of the half-sites in W Phi has no significant effect on the capacity to repress Pe. However, the protein-DNA complexes formed differ, as determined by electrophoretic mobility shift experiments. A difference in spontaneous phage production is observed in isogenic lysogens.

  • 2.
    Alexeyenko, Andrey
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Schmitt, Thomas
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Tjärnberg, Andreas
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Guala, Dmitri
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Frings, Oliver
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Comparative interactomics with Funcoup 2.02012In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 40, no D1, p. D821-D828Article in journal (Refereed)
    Abstract [en]

    FunCoup ( is a database that maintains and visualizes global gene/protein networks of functional coupling that have been constructed by Bayesian integration of diverse high-throughput data. FunCoup achieves high coverage by orthology-based integration of data sources from different model organisms and from different platforms. We here present release 2.0 in which the data sources have been updated and the methodology has been refined. It contains a new data type Genetic Interaction, and three new species: chicken, dog and zebra fish. As FunCoup extensively transfers functional coupling information between species, the new input datasets have considerably improved both coverage and quality of the networks. The number of high-confidence network links has increased dramatically. For instance, the human network has more than eight times as many links above confidence 0.5 as the previous release. FunCoup provides facilities for analysing the conservation of subnetworks in multiple species. We here explain how to do comparative interactomics on the FunCoup website.

  • 3. Al-Minawi, Ali Z.
    et al.
    Lee, Yin-Fai
    Håkansson, Daniel
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Johansson, Fredrik
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Lundin, Cecilia
    Saleh-Gohari, Nasrollah
    Schultz, Niklas
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Jenssen, Dag
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Bryant, Helen E.
    Meuth, Mark
    Hinz, John M.
    Helleday, Thomas
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    The ERCC1/XPF endonuclease is required for completion of homologous recombination at DNA replication forks stalled by inter-strand cross-links2009In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 37, no 19, p. 6400-6413Article in journal (Refereed)
    Abstract [en]

    Both the ERCC1-XPF complex and the proteins involved in homoIogous recombination (HR) have critical roles in inter-strand cross-link (ICL) repair. Here, we report that mitomycin C-induced lesions inhibit replication fork elongation. Furthermore, mitomycin C-induced DNA double-strand breaks (DSBs) are the result of the collapse of ICL-stalled replication forks. These are not formed through replication run off, as we show that mitomycin C or cisplatin-induced DNA lesions are not incised by global genome nucleotide excision repair (GGR). We also suggest that ICL-lesion repair is initiated either by replication or transcription, as the GGR does not incise ICL-lesions. Furthermore, we report that RAD51 foci are induced by cisplatin or mitomycin C independently of ERCC1, but that mitomycin C-induced HR measured in a reporter construct is impaired in ERCC1-defective cells. These data suggest that ERCC1-XPF plays a role in completion of HR in ICL repair. We also find no additional sensitivity to cisplatin by siRNA co-depletion of XRCC3 and ERCC1, showing that the two proteins act on the same pathway to promote survival.

  • 4.
    Al-Minawi, Ali Z
    et al.
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Saleh-Gohari, Nasrollah
    Helleday, Thomas
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    The ERCC1/XPF endonuclease is required for efficient single-strand annealing and gene conversion in mammalian cells2008In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 36, no 1, p. 1-9Article in journal (Refereed)
    Abstract [en]

    The mammalian ERCC1-XPF endonuclease has a suggested role in the repair of DNA double-strand breaks (DSB) by single-strand annealing (SSA). Here, we investigated the role of ERCC1 in homologous recombination in mammalian cells, and confirm a role of ERCC1 in SSA. Interestingly, we also report an unexpected role for ERCC1 in gene conversion. This provides support that gene conversion in mammalian somatic cells is carried out through synthesis-dependent strand annealing, rather than through a double Holliday Junction mechanism. Moreover, we find low frequencies of SSA and gene conversion in G1-arrested cells, suggesting that SSA is not a frequent DSB repair pathway in G1-arrested mammalian cells, even in the presence of perfect repeats. Furthermore, we find that SSA is not influenced by inhibition of CDK2 (using Roscovitine), ATM (using Caffeine and KU55933), Chk1 (using CEP-3891) or DNA-PK (using NU7026).

  • 5. Anantharaman, Aparna
    et al.
    Tripathi, Vidisha
    Khan, Abid
    Yoon, Je-Hyun
    Singh, Deepak K.
    Gholamalamdari, Omid
    Guang, Shuomeng
    Ohlson, Johan
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Wahlstedt, Helene
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Öhman, Marie
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Jantsch, Michael F.
    Conrad, Nicholas K.
    Ma, Jian
    Gorospe, Myriam
    Prasanth, Supriya G.
    Prasanth, Kannanganattu V.
    ADAR2 regulates RNA stability by modifying access of decay-promoting RNA-binding proteins2017In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 45, no 7, p. 4189-4201Article in journal (Refereed)
    Abstract [en]

    Adenosine deaminases acting on RNA (ADARs) catalyze the editing of adenosine residues to inosine (A-to-I) within RNA sequences, mostly in the introns and UTRs (un-translated regions). The significance of editing within non-coding regions of RNA is poorly understood. Here, we demonstrate that association of ADAR2 with RNA stabilizes a subset of transcripts. ADAR2 interacts with and edits the 3' UTR of nuclear-retained Cat2 transcribed nuclear RNA (Ctn RNA). In absence of ADAR2, the abundance and half-life of Ctn RNA are significantly reduced. Furthermore, ADAR2-mediated stabilization of Ctn RNA occurred in an editing-independent manner. Unedited Ctn RNA shows enhanced interaction with the RNA-binding proteins HuR and PARN [Poly(A) specific ribonuclease deadenylase]. HuR and PARN destabilize Ctn RNA in absence of ADAR2, indicating that ADAR2 stabilizes Ctn RNA by antagonizing its degradation by PARN and HuR. Transcriptomic analysis identified other RNAs that are regulated by a similar mechanism. In summary, we identify a regulatory mechanism whereby ADAR2 enhances target RNA stability by limiting the interaction of RNA-destabilizing proteins with their cognate substrates.

  • 6. Aparicio-Puerta, Ernesto
    et al.
    Lebron, Ricardo
    Rueda, Antonio
    Gomez-Martin, Cristina
    Giannoukakos, Stavros
    Jaspez, David
    Maria Medina, Jose
    Zubkovic, Andreja
    Jurak, Igor
    Fromm, Bastian
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Antonio Marchal, Juan
    Oliver, Jose
    Hackenberg, Michael
    sRNAbench and sRNAtoolbox 2019: intuitive fast small RNA profiling and differential expression2019In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 47, no W1, p. W530-W535Article in journal (Refereed)
    Abstract [en]

    Since the original publication of sRNAtoolbox in 2015, small RNA research experienced notable advances in different directions. New protocols for small RNA sequencing have become available to address important issues such as adapter ligation bias, PCR amplification artefacts or to include internal controls such as spike-in sequences. New microRNA reference databases were developed with different foci, either prioritizing accuracy (low number of false positives) or completeness (low number of false negatives). Additionally, other small RNA molecules as well asmicroRNA sequence and length variants (isomiRs) have continued to gain importance. Finally, the number of microRNA sequencing studies deposited in GEO nearly triplicated from 2014 (280) to 2018 (764). These developments imply that fast and easy-to-use tools for expression profiling and subsequent downstream analysis of miRNAseq data are essential to many researchers. Key features in this sRNAtoolbox release include addition of all major RNA library preparation protocols to sRNAbench and improvements in sRNAde, a tool that summarizes several aspects of small RNA sequencing studies including the detection of consensus differential expression. A special emphasis was put on the user-friendliness of the tools, for instance sRNAbench now supports parallel launching of several jobs to improve reproducibility and user time efficiency.

  • 7. Berglund, Ann-Charlotte
    et al.
    Sjölund, Erik
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Östlund, Gabriel
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    InParanoid 6: eukaryotic ortholog clusters with inparalogs2008In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 36, p. D263-D266Article in journal (Refereed)
    Abstract [en]

    The InParanoid eukaryotic ortholog database ( has been updated to version 6 and is now based on 35 species. We collected all available 'complete' eukaryotic proteomes and Escherichia coli, and calculated ortholog groups for all 595 species pairs using the InParanoid program. This resulted in 2 642 187 pairwise ortholog groups in total. The orthology-based species relations are presented in an orthophylogram. InParanoid clusters contain one or more orthologs from each of the two species. Multiple orthologs in the same species, i.e. inparalogs, result from gene duplications after the species divergence. A new InParanoid website has been developed which is optimized for speed both for users and for updating the system. The XML output format has been improved for efficient processing of the InParanoid ortholog clusters.

  • 8.
    Bergqvist, Cecilia
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Niss, Frida
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Figueroa, Ricardo A.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Beckman, Marie
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Karolinska Institutet, Sweden.
    Maksel, Danuta
    Jafferali, Mohammed H.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Kulyté, Agné
    Ström, Anna-Lena
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Hallberg, Einar
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Monitoring of chromatin organization in live cells by FRIC. Effects of the inner nuclear membrane protein Samp12019In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 47, no 9, article id e49Article in journal (Refereed)
    Abstract [en]

    In most cells, transcriptionally inactive heterochromatin is preferentially localized in the nuclear periphery and transcriptionally active euchromatin is localized in the nuclear interior. Different cell types display characteristic chromatin distribution patterns, which change dramatically during cell differentiation, proliferation, senescence and different pathological conditions. Chromatin organization has been extensively studied on a cell population level, but there is a need to understand dynamic reorganization of chromatin at the single cell level, especially in live cells. We have developed a novel image analysis tool that we term Fluorescence Ratiometric Imaging of Chromatin (FRIC) to quantitatively monitor dynamic spatiotemporal distribution of euchromatin and total chromatin in live cells. A vector (pTandemH) assures stoichiometrically constant expression of the histone variants Histone 3.3 and Histone 2B, fused to EGFP and mCherry, respectively. Quantitative ratiometric (H3.3/H2B) imaging displayed a concentrated distribution of heterochromatin in the periphery of U2OS cell nuclei. As proof of concept, peripheral heterochromatin responded to experimental manipulation of histone acetylation. We also found that peripheral heterochromatin depended on the levels of the inner nuclear membrane protein Samp1, suggesting an important role in promoting peripheral heterochromatin. Taken together, FRIC is a powerful and robust new tool to study dynamic chromatin redistribution in live cells.

  • 9.
    Bernsel, Andreas
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Viklund, Håkan
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Hennerdal, Aron
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Elofsson, Arne
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    TOPCONS: consensus prediction of membrane protein topology2009In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 37, no Suppl. 2, p. W465-W468Article in journal (Refereed)
    Abstract [en]

    TOPCONS ( is a web server for consensus prediction of membrane protein topology. The underlying algorithm combines an arbitrary number of topology predictions into one consensus prediction and quantifies the reliability of the prediction based on the level of agreement between the underlying methods, both on the protein level and on the level of individual TM regions. Benchmarking the method shows that overall performance levels match the best available topology prediction methods, and for sequences with high reliability scores, performance is increased by approximately 10 percentage points. The web interface allows for constraining parts of the sequence to a known inside/outside location, and detailed results are displayed both graphically and in text format.

  • 10.
    Berntsson, Ronnie P. -A.
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Odegrip, Richard
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Sehlén, Wilhelmina
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Skaar, Karin
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Svensson, Linda M.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Massad, Tariq
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Högbom, Martin
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Haggard-Ljungquist, Elisabeth
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Stenmark, Pål
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Structural insight into DNA binding and oligomerization of the multifunctional Cox protein of bacteriophage P22014In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 42, no 4, p. 2725-2735Article in journal (Refereed)
    Abstract [en]

    The Cox protein from bacteriophage P2 is a small multifunctional DNA-binding protein. It is involved in site-specific recombination leading to P2 prophage excision and functions as a transcriptional repressor of the P2 Pc promoter. Furthermore, it transcriptionally activates the unrelated, defective prophage P4 that depends on phage P2 late gene products for lytic growth. In this article, we have investigated the structural determinants to understand how P2 Cox performs these different functions. We have solved the structure of P2 Cox to 2.4 angstrom resolution. Interestingly, P2 Cox crystallized in a continuous oligomeric spiral with its DNA-binding helix and wing positioned outwards. The extended C-terminal part of P2 Cox is largely responsible for the oligomerization in the structure. The spacing between the repeating DNA-binding elements along the helical P2 Cox filament is consistent with DNA binding along the filament. Functional analyses of alanine mutants in P2 Cox argue for the importance of key residues for protein function. We here present the first structure from the Cox protein family and, together with previous biochemical observations, propose that P2 Cox achieves its various functions by specific binding of DNA while wrapping the DNA around its helical oligomer.

  • 11.
    Bonath, Franziska
    et al.
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Domingo-Prim, Judit
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Tarbier, Marcel
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Friedländer, Marc R.
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Visa, Neus
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Next-generation sequencing reveals two populations of damage-induced small RNAs at endogenous DNA double-strand breaks2018In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 46, no 22, p. 11869-11882Article in journal (Refereed)
    Abstract [en]

    Recent studies suggest that transcription takes place at DNA double-strand breaks (DSBs), that transcripts at DSBs are processed by Drosha and Dicer into damage-induced small RNAs (diRNAs), and that diRNAs are required for DNA repair. However, diRNAs have been mostly detected in reporter constructs or repetitive sequences, and their existence at endogenous loci has been questioned by recent reports. Using the homing endonuclease I-PpoI, we have investigated diRNA production in genetically unperturbed human and mouse cells. I-PpoI is an ideal tool to clarify the requirements for diRNA production because it induces DSBs in different types of loci: the repetitive 28S locus, unique genes and intergenic loci. We show by extensive sequencing that the rDNA locus produces substantial levels of diRNAs, whereas unique genic and intergenic loci do not. Further characterization of diRNAs emerging from the 28S locus reveals the existence of two diRNA subtypes. Surprisingly, Drosha and its partner DGCR8 are dispensable for diRNA production and only one diRNAs subtype depends on Dicer processing. Furthermore, we provide evidence that diRNAs are incorporated into Argonaute. Our findings provide direct evidence for diRNA production at endogenous loci in mammalian cells and give insights into RNA processing at DSBs.

  • 12.
    Bonath, Franziska
    et al.
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Domingo-Prim, Judit
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Tarbier, Marcel
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Friedländer, Marc
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Visa, Neus
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Next-generation sequencing reveals two populations of damage- induced small RNAs at endogenous DNA double-strand breaksIn: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962Article in journal (Refereed)
  • 13.
    Brindefalk, Björn
    et al.
    Stockholm University, Faculty of Science, Department of Botany.
    Dessailly, Benoit H.
    Yeats, Corin
    Orengo, Christine
    Werner, Finn
    Poole, Anthony M.
    Evolutionary history of the TBP-domain superfamily2013In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 41, no 5, p. 2832-2845Article in journal (Refereed)
    Abstract [en]

    The TATA binding protein (TBP) is an essential transcription initiation factor in Archaea and Eucarya. Bacteria lack TBP, and instead use sigma factors for transcription initiation. TBP has a symmetric structure comprising two repeated TBP domains. Using sequence, structural and phylogenetic analyses, we examine the distribution and evolutionary history of the TBP domain, a member of the helix-grip fold family. Our analyses reveal a broader distribution than for TBP, with TBP-domains being present across all three domains of life. In contrast to TBP, all other characterized examples of the TBP domain are present as single copies, primarily within multidomain proteins. The presence of the TBP domain in the ubiquitous DNA glycosylases suggests that this fold traces back to the ancestor of all three domains of life. The TBP domain is also found in RNase HIII, and phylogenetic analyses show that RNase HIII has evolved from bacterial RNase HII via TBP-domain fusion. Finally, our comparative genomic screens confirm and extend earlier reports of proteins consisting of a single TBP domain among some Archaea. These monopartite TBP-domain proteins suggest that this domain is functional in its own right, and that the TBP domain could have first evolved as an independent protein, which was later recruited in different contexts.

  • 14.
    Chammiran, Daniel
    et al.
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Veno, Morten T.
    Ekdahl, Ylva
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Kjems, Jörgen
    Öhman, Marie
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    A distant cis acting intronic element induces site-selective RNA editing2012In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 40, no 19, p. 9876-9886Article in journal (Refereed)
    Abstract [en]

    Transcripts have been found to be site selectively edited from adenosine-to-inosine (A-to-I) in the mammalian brain, mostly in genes involved in neurotransmission. While A-to-I editing occurs at double-stranded structures, other structural requirements are largely unknown. We have investigated the requirements for editing at the I/M site in the Gabra-3 transcript of the GABA(A) receptor. We identify an evolutionarily conserved intronic duplex, 150 nt downstream of the exonic hairpin where the I/M site resides, which is required for its editing. This is the first time a distant RNA structure has been shown to be important for A-to-I editing. We demonstrate that the element also can induce editing in related but normally not edited RNA sequences. In human, thousands of genes are edited in duplexes formed by inverted repeats in non-coding regions. It is likely that numerous such duplexes can induce editing of coding regions throughout the transcriptome.

  • 15.
    Crona, Mikael
    et al.
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Sjöberg, Britt-Marie
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Moffatt, Connor
    Department of Biochemistry, Schulich School of Medicine and Dentistry, University of Western Ontario.
    Edgell, David R.
    Department of Biochemistry, Schulich School of Medicine and Dentistry, University of Western Ontario.
    Friedrich, Nancy C.
    Department of Biochemistry, Schulich School of Medicine and Dentistry, University of Western Ontario.
    Hofer, Anders
    Department of Medical Biochemistry and Biophysics, Umeå University.
    Assembly of a fragmented ribonucleotide reductase by protein interaction domains derived from a mobile genetic element2011In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 39, no 4, p. 1381-1389Article in journal (Refereed)
    Abstract [en]

    Ribonucleotide reductase (RNR) is a critical enzyme of nucleotide metabolism, synthesizing precursors for DNA replication and repair. In prokaryotic genomes, RNR genes are commonly targeted by mobile genetic elements, including free standing and intron-encoded homing endonucleases and inteins. Here, we describe a unique molecular solution to assemble a functional product from the RNR large subunit gene, nrdA that has been fragmented into two smaller genes by the insertion of mobE, a mobile endonuclease. We show that unique sequences that originated during the mobE insertion and that are present as C- and N-terminal tails on the split NrdA-a and NrdA-b polypeptides, are absolutely essential for enzymatic activity. Our data are consistent with the tails functioning as protein interaction domains to assemble the tetrameric (NrdA-a/NrdA-b)2 large subunit necessary for a functional RNR holoenzyme. The tails represent a solution distinct from RNA and protein splicing or programmed DNA rearrangements to restore function from a fragmented coding region and may represent a general mechanism to neutralize fragmentation of essential genes by mobile genetic elements.

  • 16.
    EL Andaloussi, Samir
    et al.
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Lehto, Taavi
    Mäger, Imre
    Rosenthal-Aizman, Katri
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Oprea, Iulian I.
    Simonson, Oscar E.
    Sork, Helena
    Ezzat, Kariem
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Copolovici, Dana M.
    Kurrikoff, Kaido
    Viola, Joana R.
    Zaghloul, Eman M.
    Sillard, Rannar
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Johansson, Henrik J.
    Said Hassane, Fatouma
    Guterstam, Peter
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Suhorutsenko, Julia
    Moreno, Pedro M. D.
    Oskolkov, Nikita
    Hälldin, Jonas
    Tedebark, Ulf
    Metspalu, Andres
    Lebleu, Bernard
    Lehtiö, Janne
    Smith, C. I. Edvard
    Langel, Ülo
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Design of a peptide-based vector, PepFect6, for efficient delivery of siRNA in cell culture and systemically in vivo2011In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 39, no 9, p. 3972-3987Article in journal (Refereed)
    Abstract [en]

    While small interfering RNAs (siRNAs) have been rapidly appreciated to silence genes, efficient and non-toxic vectors for primary cells and for systemic in vivo delivery are lacking. Several siRNA-delivery vehicles, including cell-penetrating peptides (CPPs), have been developed but their utility is often restricted by entrapment following endocytosis. Hence, developing CPPs that promote endosomal escape is a prerequisite for successful siRNA implementation. We here present a novel CPP, PepFect 6 (PF6), comprising the previously reported stearyl-TP10 peptide, having pH titratable trifluoromethylquinoline moieties covalently incorporated to facilitate endosomal release. Stable PF6/siRNA nanoparticles enter entire cell populations and rapidly promote endosomal escape, resulting in robust RNAi responses in various cell types (including primary cells), with minimal associated transcriptomic or proteomic changes. Furthermore, PF6-mediated delivery is independent of cell confluence and, in most cases, not significantly hampered by serum proteins. Finally, these nanoparticles promote strong RNAi responses in different organs following systemic delivery in mice without any associated toxicity. Strikingly, similar knockdown in liver is achieved by PF6/siRNA nanoparticles and siRNA injected by hydrodynamic infusion, a golden standard technique for liver transfection. These results imply that the peptide, in addition to having utility for RNAi screens in vitro, displays therapeutic potential.

  • 17. El-Gebali, Sara
    et al.
    Mistry, Jaina
    Bateman, Alex
    Eddy, Sean R.
    Luciani, Aurelien
    Potter, Simon C.
    Qureshi, Matloob
    Richardson, Lorna J.
    Salazar, Gustavo A.
    Smart, Alfredo
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Hirsh, Layla
    Paladin, Lisanna
    Piovesan, Damiano
    Tosatto, Silvio C. E.
    Finn, Robert D.
    The Pfam protein families database in 20192019In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 47, no D1, p. D427-D432Article in journal (Refereed)
    Abstract [en]

    The last few years have witnessed significant changes in Pfam ( The number of families has grown substantially to a total of 17,929 in release 32.0. New additions have been coupled with efforts to improve existing families, including refinement of domain boundaries, their classification into Pfam clans, as well as their functional annotation. We recently began to collaborate with the RepeatsDB resource to improve the definition of tandem repeat families within Pfam. We carried out a significant comparison to the structural classification database, namely the Evolutionary Classification of Protein Domains (ECOD) that led to the creation of 825 new families based on their set of uncharacterized families(EUFs). Furthermore, we also connected Pfam entries to the Sequence Ontology (SO) through mapping of the Pfam type definitions to SO terms. Since Pfam has many community contributors, we recently enabled the linking between authorship of all Pfam entries with the corresponding authors' ORCID identifiers. This effectively permits authors to claim credit for their Pfam curation and link them to their ORCID record.

  • 18.
    Elvers, Ingegerd
    et al.
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Hagenkort, Anna
    Stockholm University, Science for Life Laboratory (SciLifeLab).
    Johansson, Fredrik
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Djureinovic, Tatjana
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Lagerqvist, Anne
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Schultz, Niklas
    Stockholm University, Science for Life Laboratory (SciLifeLab).
    Stoimenov, Ivaylo
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Erixon, Klaus
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Helleday, Thomas
    Stockholm University, Science for Life Laboratory (SciLifeLab).
    CHK1 activity is required for continuous replication fork elongation but not stabilization of post-replicative gaps after UV irradiation2012In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 40, no 17, p. 8440-8448Article in journal (Refereed)
    Abstract [en]

    Ultraviolet (UV)-induced DNA damage causes an efficient block of elongating replication forks. The checkpoint kinase, CHK1 has been shown to stabilize replication forks following hydroxyurea treatment. Therefore, we wanted to test if the increased UV sensitivity caused by the unspecific kinase inhibitor caffeine-inhibiting ATM and ATR amongst other kinases-is explained by inability to activate the CHK1 kinase to stabilize replicative structures. For this, we used cells deficient in polymerase eta (Pol eta), a translesion synthesis polymerase capable of properly bypassing the UV-induced cis-syn TT pyrimidine dimer, which blocks replication. These cells accumulate gaps behind progressing replication forks after UV exposure. We demonstrate that both caffeine and CHK1 inhibition, equally retards continuous replication fork elongation after UV treatment. Interestingly, we found more pronounced UV-sensitization by caffeine than with the CHK1 inhibitor in clonogenic survival experiments. Furthermore, we demonstrate an increased collapse of replicative structures after caffeine treatment, but not after CHK1 inhibition, in UV-irradiated cells. This demonstrates that CHK1 activity is not required for stabilization of gaps induced during replication of UV-damaged DNA. These data suggest that elongation and stabilization of replicative structures at UV-induced DNA damage are distinct mechanisms, and that CHK1 is only involved in replication elongation.

  • 19.
    Elvers, Ingegerd
    et al.
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Johansson, Fredrik
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Groth, Petra
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Erixon, Klaus
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Helleday, Thomas
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    UV stalled replication forks restart by re-priming in human fibroblasts2011In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 39, no 16, p. 7049-7057Article in journal (Refereed)
    Abstract [en]

    Restarting stalled replication forks is vital to avoid fatal replication errors. Previously, it was demonstrated that hydroxyurea-stalled replication forks use an active restart mechanism or rescue replication by new origin firing. Using the DNA fiber assay, we find to our surprise no evidence that UV-damaged replication forks are arrested and only detect a slightly reduced fork speed on a UV-damaged template. Interestingly, no evidence for UV-induced fork stalling was observed even in translesion synthesis defective, Polηmut cells. In contrast, using an assay to measure DNA molecule elongation at the fork, we observe that DNA elongation is severely blocked, particularly in UV-damaged Polηmut cells. In conclusion, these data suggest that UV-blocked replication forks restart effectively through re-priming. If left unfilled, the gap behind a re-primed fork may collapse into a DNA double-strand break that is repaired by a recombination pathway, similar to the fate of replication forks collapsed after hydroxyurea treatment.

  • 20.
    Ensterö, Mats
    et al.
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Daniel, Chammiran
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Wahlstedt, Helene
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Major, Francois
    Öhman, Marie
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Recognition and coupling af A-to-I edited sites are determined by the tertiary structure of the RNA2009In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 37, no 20, p. 6916-6926Article in journal (Refereed)
    Abstract [en]

    Adenosine-to-inosine (A-to-I) editing has been shown to be an important mechanism that increases protein diversity in the brain of organisms from human to fly. The family of ADAR enzymes converts some adenosines of RNA duplexes to inosines through hydrolytic deamination. The adenosine recognition mechanism is still largely unknown. Here, to investigate it, we analyzed a set of selectively edited substrates with a cluster of edited sites. We used a large set of individual transcripts sequenced by the 454 sequencing technique. On average, we analyzed 570 single transcripts per edited region at four different developmental stages from embryogenesis to adulthood. To our knowledge, this is the first time, large-scale sequencing has been used to determine synchronous editing events. We demonstrate that edited sites are only coupled within specific distances from each other. Furthermore, our results show that the coupled sites of editing are positioned on the same side of a helix, indicating that the three-dimensional structure is key in ADAR enzyme substrate recognition. Finally, we propose that editing by the ADAR enzymes is initiated by their attraction to one principal site in the substrate.

  • 21.
    Ezzat, Kariem
    et al.
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    EL Andaloussi, Samir
    Zaghloul, Eman M.
    Lehto, Taavi
    Lindberg, Staffan
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Moreno, Pedro M. D.
    Viola, Joana R.
    Magdy, Tarek
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Abdo, Rania
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Guterstam, Peter
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Sillard, Rannar
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Hammond, Suzan M.
    Wood, Matthew J. A.
    Arzumanov, Andrey A.
    Gait, Michael J.
    Smith, C. I. Edvard
    Hällbrink, Mattias
    Stockholm University, Faculty of Science, Department of Neurochemistry.
    Langel, Ülo
    Stockholm University, Faculty of Science, Department of Neurochemistry. University of Tartu, Estonia.
    PepFect 14, a novel cell-penetrating peptide for oligonucleotide delivery in solution and as solid formulation2011In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 39, no 12, p. 5284-5298Article in journal (Refereed)
    Abstract [en]

    Numerous human genetic diseases are caused by mutations that give rise to aberrant alternative splicing. Recently, several of these debilitating disorders have been shown to be amenable for splice-correcting oligonucleotides (SCOs) that modify splicing patterns and restore the phenotype in experimental models. However, translational approaches are required to transform SCOs into usable drug products. In this study, we present a new cell-penetrating peptide, PepFect14 (PF14), which efficiently delivers SCOs to different cell models including HeLa pLuc705 and mdx mouse myotubes; a cell culture model of Duchenne's muscular dystrophy (DMD). Non-covalent PF14-SCO nanocomplexes induce splice-correction at rates higher than the commercially available lipid-based vector Lipofectamine™ 2000 (LF2000) and remain active in the presence of serum. Furthermore, we demonstrate the feasibility of incorporating this delivery system into solid formulations that could be suitable for several therapeutic applications. Solid dispersion technique is utilized and the formed solid formulations are as active as the freshly prepared nanocomplexes in solution even when stored at an elevated temperatures for several weeks. In contrast, LF2000 drastically loses activity after being subjected to same procedure. This shows that using PF14 is a very promising translational approach for the delivery of SCOs in different pharmaceutical forms.

  • 22. Finn, Robert D.
    et al.
    Bateman, Alex
    Clements, Jody
    Coggill, Penelope
    Eberhardt, Ruth Y.
    Eddy, Sean R.
    Heger, Andreas
    Hetherington, Kirstie
    Holm, Liisa
    Mistry, Jaina
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Tate, John
    Punta, Marco
    Pfam: the protein families database2014In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 42, no D1, p. d222-D230Article in journal (Refereed)
    Abstract [en]

    Pfam, available via servers in the UK ( and the USA (, is a widely used database of protein families, containing 14 831 manually curated entries in the current release, version 27.0. Since the last update article 2 years ago, we have generated 1182 new families and maintained sequence coverage of the UniProt Knowledgebase (UniProtKB) at nearly 80%, despite a 50% increase in the size of the underlying sequence database. Since our 2012 article describing Pfam, we have also undertaken a comprehensive review of the features that are provided by Pfam over and above the basic family data. For each feature, we determined the relevance, computational burden, usage statistics and the functionality of the feature in a website context. As a consequence of this review, we have removed some features, enhanced others and developed new ones to meet the changing demands of computational biology. Here, we describe the changes to Pfam content. Notably, we now provide family alignments based on four different representative proteome sequence data sets and a new interactive DNA search interface. We also discuss the mapping between Pfam and known 3D structures.

  • 23. Finn, Robert D.
    et al.
    Mistry, Jaina
    Tate, John
    Coggill, Penny
    Heger, Andreas
    Pollington, Joanne E.
    Gavin, O. Luke
    Gunasekaran, Prasad
    Ceric, Goran
    Forslund, Kristoffer
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Holm, Liisa
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Eddy, Sean R.
    Bateman, Alex
    The Pfam protein families database2010In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 38, p. d211-d222Article in journal (Refereed)
    Abstract [en]

    Pfam is a widely used database of protein families and domains. This article describes a set of major updates that we have implemented in the latest release (version 24.0). The most important change is that we now use HMMER3, the latest version of the popular profile hidden Markov model package. This software is similar to 100 times faster than HMMER2 and is more sensitive due to the routine use of the forward algorithm. The move to HMMER3 has necessitated numerous changes to Pfam that are described in detail. Pfam release 24.0 contains 11 912 families, of which a large number have been significantly updated during the past two years. Pfam is available via servers in the UK (, the USA ( and Sweden (

  • 24.
    Fritzell, Kajsa
    et al.
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Xu, Li-Di
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Otrocka, Magdalena
    Andréasson, Claes
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Öhman, Marie
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Sensitive ADAR editing reporter in cancer cells enables high-throughput screening of small molecule libraries2019In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 47, no 4, article id e22Article in journal (Refereed)
    Abstract [en]

    Adenosine to inosine editing is common in the human transcriptome and changes of this essential activity is associated with disease. Children with ADAR1 mutations develop fatal Aicardi-Goutieres syndrome characterized by aberrant interferon expression. In contrast, ADAR1 overexpression is associated with increased malignancy of breast, lung and liver cancer. ADAR1 silencing in breast cancer cells leads to increased apoptosis, suggesting an anti-apoptotic function that promotes cancer progression. Yet, suitable high-throughput editing assays are needed to efficiently screen chemical libraries for modifiers of ADAR1 activity. We describe the development of a bioluminescent reporter system that facilitates rapid and accurate determination of endogenous editing activity. The system is based on the highly sensitive and quantitative Nanoluciferase that is conditionally expressed upon reporter-transcript editing. Stably introduced into cancer cell lines, the system reports on elevated endogenous ADAR1 editing activity induced by interferon as well as knockdown of ADAR1 and ADAR2. In a single-well setup we used the reporter in HeLa cells to screen a small molecule library of 33 000 compounds. This yielded a primary hit rate of 0.9% at 70% inhibition of editing. Thus, we provide a key tool for high-throughput identification of modifiers of A-to-I editing activity in cancer cells.

  • 25. Frykholm, Karolin
    et al.
    Berntsson, Ronnie Per-Arne
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Claesson, Magnus
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    de Battice, Laura
    Odegrip, Richard
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Stenmark, Pål
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Westerlund, Fredrik
    DNA compaction by the bacteriophage protein Cox studied on the single DNA molecule level using nanofluidic channels2016In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 44, no 15, p. 7219-7227Article in journal (Refereed)
    Abstract [en]

    The Cox protein from bacteriophage P2 forms oligomeric filaments and it has been proposed that DNA can be wound up around these filaments, similar to how histones condense DNA. We here use fluorescence microscopy to study single DNA-Cox complexes in nanofluidic channels and compare how the Cox homologs from phages P2 and W Phi affect DNA. By measuring the extension of nanoconfined DNA in absence and presence of Cox we show that the protein compacts DNA and that the binding is highly cooperative, in agreement with the model of a Cox filament around which DNA is wrapped. Furthermore, comparing microscopy images for the wild-type P2 Cox protein and two mutants allows us to discriminate between compaction due to filament formation and compaction by monomeric Cox. P2 and W Phi Cox have similar effects on the physical properties of DNA and the subtle, but significant, differences in DNA binding are due to differences in binding affinity rather than binding mode. The presented work highlights the use of single DNA molecule studies to confirm structural predictions from X-ray crystallography. It also shows how a small protein by oligomerization can have great impact on the organization of DNA and thereby fulfill multiple regulatory functions.

  • 26. Geny, Sylvain
    et al.
    Moreno, Pedro M. D.
    Krzywkowski, Tomasz
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Gissberg, Olof
    Andersen, Nicolai K.
    Isse, Abdirisaq J.
    El-Madani, Amro M.
    Lou, Chenguang
    Pabon, Y. Vladimir
    Anderson, Brooke A.
    Zaghloul, Eman M.
    Zain, Rula
    Hrdlicka, Patrick J.
    Jørgensen, Per T.
    Nilsson, Mats
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Lundin, Karin E.
    Pedersen, Erik B.
    Wengel, Jesper
    Smith, C. I. Edvard
    Next-generation bis-locked nucleic acids with stacking linker and 2 '-glycylamino-LNA show enhanced DNA invasion into supercoiled duplexes2016In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 44, no 5, p. 2007-2019Article in journal (Refereed)
    Abstract [en]

    Targeting and invading double-stranded DNA with synthetic oligonucleotides under physiological conditions remain a challenge. Bis-locked nucleic acids (bisLNAs) are clamp-forming oligonucleotides able to invade into supercoiled DNA via combined Hoogsteen and Watson-Crick binding. To improve the bisLNA design, we investigated its mechanism of binding. Our results suggest that bisLNAs bind via Hoogsteen-arm first, followed by Watson-Crick arm invasion, initiated at the tail. Based on this proposed hybridization mechanism, we designed next-generation bisLNAs with a novel linker able to stack to adjacent nucleobases, a new strategy previously not applied for any type of clamp-constructs. Although the Hoogsteen-arm limits the invasion, upon incorporation of the stacking linker, bisLNA invasion is significantly more efficient than for non-clamp, or nucleotide-linker containing LNA-constructs. Further improvements were obtained by substituting LNA with 2'-glycylamino-LNA, contributing a positive charge. For regular bisLNAs a 14-nt tail significantly enhances invasion. However, when two stacking linkers were incorporated, tail-less bisLNAs were able to efficiently invade. Finally, successful targeting of plasmids inside bacteria clearly demonstrates that strand invasion can take place in a biologically relevant context.

  • 27.
    Groth, Petra
    et al.
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Luis Orta, Manuel
    Elvers, Ingegerd
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Majumder, Muntasir Mamun
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Lagerqvist, Anne
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Helleday, Thomas
    Homologous recombination repairs secondary replication induced dna double strand breaks after ionizing radiation2012In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 40, no 14, p. 6585-6594Article in journal (Refereed)
    Abstract [en]

    Ionizing radiation (IR) produces direct two-ended DNA double-strand breaks (DSBs) primarily repaired by non-homologous end joining (NHEJ). It is, however, well established that homologous recombination (HR) is induced and required for repair of a subset of DSBs formed following IR. Here, we find that HR induced by IR is drastically reduced when post-DNA damage replication is inhibited in mammalian cells. Both IR-induced RAD51 foci and HR events in the hprt gene are reduced in the presence of replication polymerase inhibitor aphidicolin (APH). Interestingly, we also detect reduced IR-induced toxicity in HR deficient cells when inhibiting post-DNA damage replication. When studying DSB formation following IR exposure, we find that apart from the direct DSBs the treatment also triggers formation of secondary DSBs peaking at 7-9 h after exposure. These secondary DSBs are restricted to newly replicated DNA and abolished by inhibiting post-DNA damage replication. Further, we find that IR-induced RAD51 foci are decreased by APH only in cells replicating at the time of IR exposure, suggesting distinct differences between IR-induced HR in S- and G2-phases of the cell cycle. Altogether, our data indicate that secondary replication-associated DSBs formed following exposure to IR are major substrates for IR-induced HR repair.

  • 28. Ivanov, Maxim
    et al.
    Kals, Mart
    Lauschke, Volker
    Barragan, Isabel
    Ewels, Philip
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Käller, Max
    Axelsson, Tomas
    Lehtiö, Janne
    Milani, Lili
    Ingelman-Sundberg, Magnus
    Single base resolution analysis of 5-hydroxymethylcytosine in 188 human genes: implications for hepatic gene expression2016In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 44, no 14, p. 6756-6769Article in journal (Refereed)
    Abstract [en]

    To improve the epigenomic analysis of tissues rich in 5-hydroxymethylcytosine (hmC), we developed a novel protocol called TAB-Methyl-SEQ, which allows for single base resolution profiling of both hmC and 5-methylcytosine by targeted next-generation sequencing. TAB-Methyl-SEQ data were extensively validated by a set of five methodologically different protocols. Importantly, these extensive cross-comparisons revealed that protocols based on Tet1-assisted bisulfite conversion provided more precise hmC values than TrueMethyl-based methods. A total of 109 454 CpG sites were analyzed by TAB-Methyl-SEQ for mC and hmC in 188 genes from 20 different adult human livers. We describe three types of variability of hepatic hmC profiles: (i) sample-specific variability at 40.8% of CpG sites analyzed, where the local hmC values correlate to the global hmC content of livers (measured by LC-MS), (ii) gene-specific variability, where hmC levels in the coding regions positively correlate to expression of the respective gene and (iii) site-specific variability, where prominent hmC peaks span only 1 to 3 neighboring CpG sites. Our data suggest that both the gene-and site-specific components of hmC variability might contribute to the epigenetic control of hepatic genes. The protocol described here should be useful for targeted DNA analysis in a variety of applications.

  • 29. Jemth, Ann-Sofie
    et al.
    Gustafsson, Robert
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Brautigam, Lars
    Henriksson, Linda
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Vallin, Karl S. A.
    Sarno, Antonio
    Almlof, Ingrid
    Homan, Evert
    Rasti, Azita
    Berglund, Ulrika Warpman
    Stenmark, Pål
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Helleday, Thomas
    MutT homologue 1 (MTH1) catalyzes the hydrolysis of mutagenic O6-methyl-dGTP2018In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 46, no 20, p. 10888-10904Article in journal (Refereed)
    Abstract [en]

    Nucleotides in the free pool are more susceptible to nonenzymatic methylation than those protected in the DNA double helix. Methylated nucleotides like O6-methyl-dGTP can be mutagenic and toxic if incorporated into DNA. Removal of methylated nucleotides from the nucleotide pool may therefore be important to maintain genome integrity. We show that MutT homologue 1 (MTH1) efficiently catalyzes the hydrolysis of O6-methyl-dGTP with a catalytic efficiency similar to that for 8-oxo-dGTP. O6-methyl-dGTP activity is exclusive to MTH1 among human NUDIX proteins and conserved through evolution but not found in bacterial MutT. We present a high resolution crystal structure of human and zebrafish MTH1 in complex with O6-methyl-dGMP. By microinjecting fertilized zebrafish eggs with O6-methyl-dGTP and inhibiting MTH1 we demonstrate that survival is dependent on active MTH1 in vivo. O6-methyl-dG levels are higher in DNA extracted from zebrafish embryos microinjected with O6-methyl-dGTP and inhibition of O6-methylguanine-DNA methyl transferase (MGMT) increases the toxicity of O6-methyl-dGTP demonstrating that O6-methyl-dGTP is incorporated into DNA. MTH1 deficiency sensitizes human cells to the alkylating agent Temozolomide, a sensitization that is more pronounced upon MGMT inhibition. These results expand the cellular MTH1 function and suggests MTH1 also is important for removal of methylated nucleotides from the nucleotide pool.

  • 30. Johnson, Stephanie
    et al.
    Lindén, Martin
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Phillips, Rob
    Department of Physics and Department of Bioengineering, California Institute of Technology.
    Sequence dependence of transcription factor-mediated DNA looping.2012In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 40, no 16, p. 7728-7738Article in journal (Refereed)
    Abstract [en]

    DNA is subject to large deformations in a wide range of biological processes. Two key examples illustrate how such deformations influence the readout of the genetic information: the sequestering of eukaryotic genes by nucleosomes and DNA looping in transcriptional regulation in both prokaryotes and eukaryotes. These kinds of regulatory problems are now becoming amenable to systematic quantitative dissection with a powerful dialogue between theory and experiment. Here, we use a single-molecule experiment in conjunction with a statistical mechanical model to test quantitative predictions for the behavior of DNA looping at short length scales and to determine how DNA sequence affects looping at these lengths. We calculate and measure how such looping depends upon four key biological parameters: the strength of the transcription factor binding sites, the concentration of the transcription factor, and the length and sequence of the DNA loop. Our studies lead to the surprising insight that sequences that are thought to be especially favorable for nucleosome formation because of high flexibility lead to no systematically detectable effect of sequence on looping, and begin to provide a picture of the distinctions between the short length scale mechanics of nucleosome formation and looping.

  • 31. Johnson, Stephanie
    et al.
    van de Meent, Jan-Willem
    Phillips, Rob
    Wiggins, Chris H.
    Lindén, Martin
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Uppsala University, Sweden.
    Multiple LacI-mediated loops revealed by Bayesian statistics and tethered particle motion2014In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 42, no 16, p. 10265-77Article in journal (Refereed)
    Abstract [en]

    The bacterial transcription factor LacI loops DNA by binding to two separate locations on the DNA simultaneously. Despite being one of the best-studied model systems for transcriptional regulation, the number and conformations of loop structures accessible to LacI remain unclear, though the importance of multiple coexisting loops has been implicated in interactions between LacI and other cellular regulators of gene expression. To probe this issue, we have developed a new analysis method for tethered particle motion, a versatile and commonly used in vitro single-molecule technique. Our method, vbTPM, performs variational Bayesian inference in hidden Markov models. It learns the number of distinct states (i.e. DNA-protein conformations) directly from tethered particle motion data with better resolution than existing methods, while easily correcting for common experimental artifacts. Studying short (roughly 100 bp) LacI-mediated loops, we provide evidence for three distinct loop structures, more than previously reported in single-molecule studies. Moreover, our results confirm that changes in LacI conformation and DNA-binding topology both contribute to the repertoire of LacI-mediated loops formed in vitro, and provide qualitatively new input for models of looping and transcriptional regulation. We expect vbTPM to be broadly useful for probing complex protein-nucleic acid interactions.

  • 32.
    Kaduk, Mateusz
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Riegler, Christian
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab). FH OÖ - University of Applied Sciences Upper Austria, Austria.
    Lemp, Oliver
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab). FH OÖ - University of Applied Sciences Upper Austria, Austria.
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    HieranoiDB: a database of orthologs inferred by Hieranoid2017In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 45, no D1, p. D687-D690Article in journal (Refereed)
    Abstract [en]

    HieranoiDB ( is a freely available on-line database for hierarchical groups of orthologs inferred by the Hieranoid algorithm. It infers orthologs at each node in a species guide tree with the InParanoid algorithm as it progresses from the leaves to the root. Here we present a database HieranoiDB with a web interface that makes it easy to search and visualize the output of Hieranoid, and to download it in various formats. Searching can be performed using protein description, identifier or sequence. In this first version, orthologs are available for the 66 Quest for Orthologs reference proteomes. The ortholog trees are shown graphically and interactively with marked speciation and duplication nodes that show the inferred evolutionary scenario, and allow for correct extraction of predicted orthologs from the Hieranoid trees.

  • 33.
    Kazemi, Masoud
    et al.
    Stockholm University, Faculty of Science, Department of Organic Chemistry. Uppsala University, Sweden.
    Socan, Jaka
    Himo, Fahmi
    Stockholm University, Faculty of Science, Department of Organic Chemistry.
    Åqvist, Johan
    Mechanistic alternatives for peptide bond formation on the ribosome2018In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 46, no 11, p. 5345-5354Article in journal (Refereed)
    Abstract [en]

    The peptidyl transfer reaction on the large ribosomal subunit depends on the protonation state of the amine nucleophile and exhibits a large kinetic solvent isotope effect (KSIE similar to 8). In contrast, the related peptidyl-tRNA hydrolysis reaction involved in termination shows a KSIE of similar to 4 and a pH-rate profile indicative of base catalysis. It is, however, unclear why these reactions should proceed with different mechanisms, as the experimental data suggests. One explanation is that two competing mechanisms may be operational in the peptidyl transferase center (PTC). Herein, we explored this possibility by re-examining the previously proposed proton shuttle mechanism and testing the feasibility of general base catalysis also for peptide bond formation. We employed a large cluster model of the active site and different reaction mechanisms were evaluated by density functional theory calculations. In these calculations, the proton shuttle and general base mechanisms both yield activation energies comparable to the experimental values. However, only the proton shuttle mechanism is found to be consistent with the experimentally observed pH-rate profile and the KSIE. This suggests that the PTC promotes the proton shuttle mechanism for peptide bond formation, while prohibiting general base catalysis, although the detailed mechanism by which general base catalysis is excluded remains unclear.

  • 34. Kohler, Verena
    et al.
    Goessweiner-Mohr, Nikolaus
    Aufschnaiter, Andreas
    Fercher, Christian
    Probst, Ines
    Pavkov-Keller, Tea
    Hunger, Kristin
    Wolinski, Heimo
    Büttner, Sabrina
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. University of Graz, Austria.
    Grohmann, Elisabeth
    Keller, Walter
    TraN: A novel repressor of an Enterococcus conjugative type IV secretion system2018In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 46, no 17, p. 9201-9219Article in journal (Refereed)
    Abstract [en]

    The dissemination of multi-resistant bacteria represents an enormous burden on modern healthcare. Plasmid-borne conjugative transfer is the most prevalent mechanism, requiring a type IV secretion system that enables bacteria to spread beneficial traits, such as resistance to last-line antibiotics, among different genera. Inc18 plasmids, like the Gram-positive broad host-range plasmid pIP501, are substantially involved in propagation of vancomycin resistance from Enterococci to methicillin-resistant strains of Staphylococcus aureus. Here, we identified the small cytosolic protein TraN as a repressor of the pIP501-encoded conjugative transfer system, since deletion of traN resulted in upregulation of transfer factors, leading to highly enhanced conjugative transfer. Furthermore, we report the complex structure of TraN with DNA and define the exact sequence of its binding motif. Targeting this protein-DNA interaction might represent a novel therapeutic approach against the spreading of antibiotic resistances.

  • 35.
    Krzywkowski, Tomasz
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Kühnemund, Malte
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Wu, Di
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Nilsson, Mats
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Limited reverse transcriptase activity of phi29 DNA polymerase2018In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 46, no 7, p. 3625-3632Article in journal (Refereed)
    Abstract [en]

    Phi29 (Phi 29) DNA polymerase is an enzyme commonly used in DNA amplification methods such as rolling circle amplification (RCA) and multiple strand displacement amplification (MDA), as well as in DNA sequencing methods such as single molecule real time (SMRT) sequencing. Here, we report the ability of phi29 DNA polymerase to amplify RNA-containing circular substrates during RCA. We found that circular substrates with single RNA substitutions are amplified at a similar amplification rate as non-chimeric DNA substrates, and that consecutive RNA pyrimidines were generally preferred over purines. We observed RCA suppression with higher number of ribonucleotide substitutions, which was partially restored by interspacing RNA bases with DNA. We show that supplementing manganese ions as cofactor supports replication of RNAs during RCA. Sequencing of the RCA products demonstrated accurate base incorporation at the RNA base with both Mn2+ and Mg2+ as cofactors during replication, proving reverse transcriptase activity of the phi29 DNA polymerase. In summary, the ability of phi29 DNA polymerase to accept RNA-containing substrates broadens the spectrum of applications for phi29 DNA polymerase-mediated RCA. These include amplification of chimeric circular probes, such as padlock probes and molecular inversion probes.

  • 36.
    Krzywkowski, Tomasz
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Nilsson, Mats
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Fidelity of RNA templated end-joining by chlorella virus DNA ligase and a novel iLock assay with improved direct RNA detection accuracy2017In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 45, no 18, article id e161Article in journal (Refereed)
    Abstract [en]

    Ligation-based nucleic acid detection methods are primarily limited to DNA, since they exhibit poor performance on RNA. This is attributed to reduced end-joining efficiency and/or fidelity of ligases. Interestingly, chlorella virus DNA ligase (PBCV-1 DNA ligase) has recently been shown to possess high RNA-templated DNA end-joining activity; however, its fidelity has not yet been systematically evaluated. Herein, we characterized PBCV-1 ligase for its RNA-templated end-joining fidelity at single base mismatches in 3′ and 5′ DNA probe termini and found an overall limited end-joining fidelity. To improve the specificity in PBCV-1 ligase-driven RNA detection assays, we utilized structure-specific 5′ exonucleolytic activity of Thermus aquaticus DNA polymerase, used in the invader assay. In the iLock (invader padLock) probe assay, padlock probe molecules are activated prior ligation thus the base at the probe ligation junction is read twice in order to aid successful DNA ligation: first, during structure-specific invader cleavage and then during sequence-specific DNA ligation. We report two distinct iLock probe activation mechanisms and systematically evaluate the assay specificity, including single nucleotide polymorphisms on RNA, mRNA and miRNA. We show significant increase in PBCV-1 ligation fidelity in the iLock probe assay configuration for RNA detection.

  • 37.
    Källman, Annika M.
    et al.
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Sahlin, Margareta
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    Öhman, Marie
    Stockholm University, Faculty of Science, Department of Molecular Biology and Functional Genomics.
    ADAR2 A to I editing: site selectivity and editing efficiency are separate events2003In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 31, no 16, p. 4874-4881Article in journal (Refereed)
    Abstract [en]

    ADAR enzymes, adenosine deaminases that act on RNA, form a family of RNA editing enzymes that convert adenosine to inosine within RNA that is completely or largely double‐stranded. Site‐selective A→I editing has been detected at specific sites within  a few tructured pre‐mRNAs of metazoans. We have analyzed the editing selectivity of ADAR enzymes and have chosen to study the naturally edited R/G site in the pre‐mRNA of the glutamate receptor subunit B (GluR‐B). A comparison of editing by ADAR1 and ADAR2 revealed differences in the specificity of editing. Our results show that ADAR2 selectively edits the R/G site, while ADAR1 edits more promiscuously at several other adenosines in the double‐stranded stem. To further understand the mechanism of selective ADAR2 editing we have investigated the importance of internal loops in the RNA substrate. We have found that the immediate structure surrounding the editing site is important. A purine opposite to the editing site has a negative on both selectivity and efficiency of editing. More distant internal loops in the substrate were found to have minor effects on site selectivity, while efficiency of editing was found to be influenced. Finally, changes in the RNA structure that affected editing did not alter the binding abilities of ADAR2. Overall these findings suggest that binding and catalysis are independent events.                 

  • 38.
    Kühnemund, Malte
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab). Uppsala University, Sweden.
    Hernández-Neuta, Iván
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Sharif, Mohd Istiaq
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Cornaglia, Matteo
    Gijs, Martin A. M.
    Nilsson, Mats
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab). Uppsala University, Sweden.
    Sensitive and inexpensive digital DNA analysis by microfluidic enrichment of rolling circle amplified single-molecules2017In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 45, no 8, article id e59Article in journal (Refereed)
    Abstract [en]

    Single molecule quantification assays provide the ultimate sensitivity and precision for molecular analysis. However, most digital analysis techniques, i.e. droplet PCR, require sophisticated and expensive instrumentation for molecule compartmentalization, amplification and analysis. Rolling circle amplification (RCA) provides a simpler means for digital analysis. Nevertheless, the sensitivity of RCA assays has until now been limited by inefficient detection methods. We have developed a simple microfluidic strategy for enrichment of RCA products into a single field of view of a low magnification fluorescent sensor, enabling ultra-sensitive digital quantification of nucleic acids over a dynamic range from 1.2 aM to 190 fM. We prove the broad applicability of our analysis platform by demonstrating 5-plex detection of as little as ∼1 pg (∼300 genome copies) of pathogenic DNA with simultaneous antibiotic resistance marker detection, and the analysis of rare oncogene mutations. Our method is simpler, more cost-effective and faster than other digital analysis techniques and provides the means to implement digital analysis in any laboratory equipped with a standard fluorescent microscope.

  • 39.
    Lackmann, Fredrik
    et al.
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Belikov, Sergey
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Burlacu, Elena
    Granneman, Sander
    Wieslander, Lars
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute.
    Maturation of the 90S pre-ribosome requires Mrd1 dependent U3 snoRNA and 35S pre-rRNA structural rearrangements2018In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 46, no 7, p. 3692-3706Article in journal (Refereed)
    Abstract [en]

    In eukaryotes, ribosome biogenesis requires folding and assembly of the precursor rRNA (pre-rRNA) with a large number of proteins and snoRNPs into huge RNA-protein complexes. In spite of intense genetic, biochemical and high-resolution cryo-EM studies in Saccharomyces cerevisiae, information about the structure of the 35S pre-rRNA is limited. To overcome this, we performed high-throughput SHAPE chemical probing on the 35S pre-rRNA within 90S pre-ribosomes. We focused our analyses on external (5' ETS) and internal (ITS1) transcribed spacers as well as the 18S rRNA region. We show that in the 35S pre-rRNA, the central pseudoknot is not formed and the central core of the 18S rRNA is in an open configuration but becomes more constrained in 20S pre-rRNA. The essential ribosome biogenesis protein Mrd1 influences the structure of the 18S rRNA region locally and is involved in organizing the central pseudoknot and surrounding structures. We demonstrate that U3 snoRNA dynamically interacts with the 35S pre-rRNA and that Mrd1 is required for disrupting U3 snoRNA base pairing interactions in the 5' ETS. We propose that the dynamic U3 snoRNA interactions and Mrd1 are essential for establishing the structure of the central core of 18S rRNA that is required for processing and 40S subunit function.

  • 40. Le Rhun, Anaïs
    et al.
    Lecrivain, Anne-Laure
    Reimegård, Johan
    Proux-Wéra, Estelle
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Broglia, Laura
    Della Beffa, Cristina
    Charpentier, Emmanuelle
    Identification of endoribonuclease specific cleavage positions reveals novel targets of RNase III in Streptococcus pyogenes2017In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 45, no 5, p. 2329-2340Article in journal (Refereed)
    Abstract [en]

    A better understanding of transcriptional and post-transcriptional regulation of gene expression in bacteria relies on studying their transcriptome. RNA sequencing methods are used not only to assess RNA abundance but also the exact boundaries of primary and processed transcripts. Here, we developed a method, called identification of specific cleavage position (ISCP), which enables the identification of direct endoribonuclease targets in vivo by comparing the 5' and 3' ends of processed transcripts between wild type and RNase deficient strains. To demonstrate the ISCP method, we used as a model the double-stranded specific RNase III in the human pathogen Streptococcus pyogenes. We mapped 92 specific cleavage positions (SCPs) among which, 48 were previously described and 44 are new, with the characteristic 2 nucleotides 3' overhang of RNase III. Most SCPs were located in untranslated regions of RNAs. We screened for RNase III targets using transcriptomic differential expression analysis (DEA) and compared those with the RNase III targets identified using the ISCP method. Our study shows that in S. pyogenes, under standard growth conditions, RNase III has a limited impact both on antisense transcripts and on global gene expression with the expression of most of the affected genes being downregulated in an RNase III deletion mutant.

  • 41. Li, Xianghua
    et al.
    Overton, Ian M.
    Baines, Richard A.
    Keegan, Liam P.
    O'Connell, Mary A.
    Stockholm University, Faculty of Science, Department of Molecular Biosciences, The Wenner-Gren Institute. University of Edinburgh.
    The ADAR RNA editing enzyme controls neuronal excitability in Drosophila melanogaster2014In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 42, no 2, p. 1139-1151Article in journal (Refereed)
    Abstract [en]

    RNA editing by deamination of specific adenosine bases to inosines during pre-mRNA processing generates edited isoforms of proteins. Recoding RNA editing is more widespread in Drosophila than in vertebrates. Editing levels rise strongly at metamorphosis, and Adar(5G1) null mutant flies lack editing events in hundreds of CNS transcripts; mutant flies have reduced viability, severely defective locomotion and age-dependent neurodegeneration. On the other hand, overexpressing an adult dADAR isoform with high enzymatic activity ubiquitously during larval and pupal stages is lethal. Advantage was taken of this to screen for genetic modifiers; Adar overexpression lethality is rescued by reduced dosage of the Rdl (Resistant to dieldrin), gene encoding a subunit of inhibitory GABA receptors. Reduced dosage of the Gad1 gene encoding the GABA synthetase also rescues Adar overexpression lethality. Drosophila Adar(5G1) mutant phenotypes are ameliorated by feeding GABA modulators. We demonstrate that neuronal excitability is linked to dADAR expression levels in individual neurons; Adar-overexpressing larval motor neurons show reduced excitability whereas Adar(5G1) null mutant or targeted Adar knockdown motor neurons exhibit increased excitability. GABA inhibitory signalling is impaired in human epileptic and autistic conditions, and vertebrate ADARs may have a relevant evolutionarily conserved control over neuronal excitability.

  • 42. Lingner, Thomas
    et al.
    Asshauer, Kathrin Petra
    Schreiber, Fabian
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Meinicke, Peter
    CoMet-a web server for comparative functional profiling of metagenomes2011In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 39, p. w518-W523Article in journal (Refereed)
    Abstract [en]

    Analyzing the functional potential of newly sequenced genomes and metagenomes has become a common task in biomedical and biological research. With the advent of high-throughput sequencing technologies comparative metagenomics opens the way to elucidate the genetically determined similarities and differences of complex microbial communities. We developed the web server 'CoMet' (, which provides an easy-to-use comparative metagenomics platform that is well-suitable for the analysis of large collections of metagenomic short read data. CoMet combines the ORF finding and subsequent assignment of protein sequences to Pfam domain families with a comparative statistical analysis. Besides comprehensive tabular data files, the CoMet server also provides visually interpretable output in terms of hierarchical clustering and multi-dimensional scaling plots and thus allows a quick overview of a given set of metagenomic samples.

  • 43.
    Massad, Tariq
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Skaar, Karin
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Nilsson, Hanna
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Damberg, Peter
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Henriksson-Peltola, Petri
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Haggård-Ljungquist, Elisabeth
    Stockholm University, Faculty of Science, Department of Genetics, Microbiology and Toxicology.
    Högbom, Martin
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Stenmark, Pål
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Crystal structure of the P2 C-repressor: a binder of nonpalindromic direct DNA repeats2010In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 38, no 21, p. 7778-7790Article in journal (Refereed)
    Abstract [en]

    As opposed to the vast majority of prokaryoticrepressors, the immunity repressor of temperateEscherichia coli phage P2 (C) recognizes nonpalindromicdirect repeats of DNA rather thaninverted repeats. We have determined the crystalstructure of P2 C at 1.8A ° . This constitutes the firststructure solved from the family of C proteins fromP2-like bacteriophages. The structure reveals thatthe P2 C protein forms a symmetric dimer orientedto bind the major groove of two consecutive turns ofthe DNA. Surprisingly, P2 C has great similarities tobinders of palindromic sequences. Nevertheless, thetwo identical DNA-binding helixes of the symmetricP2 C dimer have to bind different DNA sequences.Helix 3 is identified as the DNA-recognition motif inP2 C by alanine scanning and the importance for theindividual residues in DNA recognition is defined.A truncation mutant shows that the disorderedC-terminus is dispensable for repressor function.The short distance between the DNA-bindinghelices together with a possible interaction betweentwo P2 C dimers are proposed to be responsible forextensive bending of the DNA. The structure providesinsight into the mechanisms behind the mutants ofP2 C causing dimer disruption, temperature sensitivityand insensitivity to the P4 antirepressor.

  • 44.
    Mignardi, Marco
    et al.
    Stockholm University, Science for Life Laboratory (SciLifeLab). Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Mezger, Anja
    Stockholm University, Science for Life Laboratory (SciLifeLab). Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Qian, Xiaoyan
    Stockholm University, Science for Life Laboratory (SciLifeLab). Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    La Fleur, Linnea
    Botling, Johan
    Larsson, Chatarina
    Nilsson, Mats
    Stockholm University, Science for Life Laboratory (SciLifeLab). Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Oligonucleotide gap-fill ligation for mutation detection and sequencing in situ2015In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 43, no 22, article id e151Article in journal (Refereed)
    Abstract [en]

    In clinical diagnostics a great need exists for targeted in situ multiplex nucleic acid analysis as the mutational status can offer guidance for effective treatment. One well-established method uses padlock probes for mutation detection and multiplex expression analysis directly in cells and tissues. Here, we use oligonucleotide gap-fill ligation to further increase specificity and to capture molecular substrates for in situ sequencing. Short oligonucleotides are joined at both ends of a padlock gap probe by two ligation events and are then locally amplified by target-primed rolling circle amplification (RCA) pre-serving spatial information. We demonstrate the specific detection of the A3243G mutation of mitochondrial DNA and we successfully characterize a single nucleotide variant in the ACTB mRNA in cells by in situ sequencing of RCA products generated by padlock gap-fill ligation. To demonstrate the clinical applicability of our assay, we show specific detection of a point mutation in the EGFR gene in fresh frozen and formalin-fixed, paraffin-embedded (FFPE) lung cancer samples and confirm the detected mutation by in situ sequencing. This approach presents several advantages over conventional padlock probes allowing simpler assay design for multiplexed mutation detection to screen for the presence of mutations in clinically relevant mutational hotspots directly in situ.

  • 45.
    Ogris, Christoph
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Guala, Dimitri
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Helleday, Thomas
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    A novel method for crosstalk analysis of biological networks: improving accuracy of pathway annotation2017In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 45, no 2, article id e8Article in journal (Refereed)
    Abstract [en]

    Analyzing gene expression patterns is a mainstay to gain functional insights of biological systems. A plethora of tools exist to identify significant enrichment of pathways for a set of differentially expressed genes. Most tools analyze gene overlap between gene sets and are therefore severely hampered by the current state of pathway annotation, yet at the same time they run a high risk of false assignments. A way to improve both true positive and false positive rates (FPRs) is to use a functional association network and instead look for enrichment of network connections between gene sets. We present a new network crosstalk analysis method BinoX that determines the statistical significance of network link enrichment or depletion between gene sets, using the binomial distribution. This is a much more appropriate statistical model than previous methods have employed, and as a result BinoX yields substantially better true positive and FPRs than was possible before. A number of benchmarks were performed to assess the accuracy of BinoX and competing methods. We demonstrate examples of how BinoX finds many biologically meaningful pathway annotations for gene sets from cancer and other diseases, which are not found by other methods.

  • 46.
    Ogris, Christoph
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Guala, Dimitri
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Kaduk, Mateusz
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    FunCoup 4: new species, data, and visualization2018In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 46, no D1, p. D601-D607Article in journal (Refereed)
    Abstract [en]

    This release of the FunCoup database ( is the fourth generation of one of the most comprehensive databases for genome-wide functional association networks. These functional associations are inferred via integrating various data types using a naive Bayesian algorithm and orthology based information transfer across different species. This approach provides high coverage of the included genomes as well as high quality of inferred interactions. In this update of FunCoup we introduce four new eukaryotic species: Schizosaccharomyces pombe, Plasmodium falciparum, Bos taurus, Oryza sativa and open the database to the prokaryotic domain by including networks for Escherichia coli and Bacillus subtilis. The latter allows us to also introduce a new class of functional association between genes - co-occurrence in the same operon. We also supplemented the existing classes of functional association: metabolic, signaling, complex and physical protein interaction with up-to-date information. In this release we switched to InParanoid v8 as the source of orthology and base for calculation of phylogenetic profiles. While populating all other evidence types with new data we introduce a new evidence type based on quantitative mass spectrometry data. Finally, the newJavaScript based network viewer provides the user an intuitive and responsive platform to further evaluate the results.

  • 47.
    Ogris, Christoph
    et al.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    Helleday, Thomas
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics.
    PathwAX: a web server for network crosstalk based pathway annotation2016In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 44, no W1, p. W105-W109Article in journal (Refereed)
    Abstract [en]

    Pathway annotation of gene lists is often used to functionally analyse biomolecular data such as gene expression in order to establish which processes are activated in a given experiment. Databases such as KEGG or GO represent collections of how genes are known to be organized in pathways, and the challenge is to compare a given gene list with the known pathways such that all true relations are identified. Most tools apply statistical measures to the gene overlap between the gene list and pathway. It is however problematic to avoid false negatives and false positives when only using the gene overlap. The pathwAX web server ( applies a different approach which is based on network crosstalk. It uses the comprehensive network FunCoup to analyse network crosstalk between a query gene list and KEGG pathways. PathwAX runs the BinoX algorithm, which employs Monte-Carlo sampling of randomized networks and estimates a binomial distribution, for estimating the statistical significance of the crosstalk. This results in substantially higher accuracy than gene overlap methods. The system was optimized for speed and allows interactive web usage. We illustrate the usage and output of pathwAX.

  • 48. Perepelytsya, Sergiy
    et al.
    Uličný, Jozef
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Nanjing Tech University, China; Petru Poni Institute of Macromolecular Chemistry, Romania.
    Mocci, Francesca
    Pattern preferences of DNA nucleotide motifs by polyamines putrescine(2+), spermidine(3+)and spermine(4+)2019In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 47, no 12, p. 6084-6097Article in journal (Refereed)
    Abstract [en]

    The interactions of natural polyamines (putrescine(2+), spermidine(3+)and spermine(4+)) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine(2+), spermidine(3+)and spermine(4+) in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

  • 49. Piovesan, Damiano
    et al.
    Tabaro, Francesco
    Micetic, Ivan
    Necci, Marco
    Quaglia, Federica
    Oldfield, Christopher J.
    Aspromonte, Maria Cristina
    Davey, Norman E.
    Davidovic, Radoslav
    Dosztanyi, Zsuzsanna
    Elofsson, Arne
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Gasparini, Alessandra
    Hatos, Andras
    Kajava, Andrey V.
    Kalmar, Lajos
    Leonardi, Emanuela
    Lazar, Tamas
    Macedo-Ribeiro, Sandra
    Macossay-Castillo, Mauricio
    Meszaros, Attila
    Minervini, Giovanni
    Murvai, Nikoletta
    Pujols, Jordi
    Roche, Daniel B.
    Salladini, Edoardo
    Schad, Eva
    Schramm, Antoine
    Szabo, Beata
    Tantos, Agnes
    Tonello, Fiorella
    Tsirigos, Konstantinos D.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Veljkovic, Nevena
    Ventura, Salvador
    Vranken, Wim
    Warholm, Per
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Uversky, Vladimir N.
    Dunker, A. Keith
    Longhi, Sonia
    Tompa, Peter
    Tosatto, Silvio C. E.
    DisProt 7.0: a major update of the database of disordered proteins2017In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 45, no D1, p. d219-D227Article in journal (Refereed)
    Abstract [en]

    The Database of Protein Disorder (DisProt, URL: has been significantly updated and upgraded since its last major renewal in 2007. The current release holds information on more than 800 entries of IDPs/IDRs, i.e. intrinsically disordered proteins or regions that exist and function without a well-defined three-dimensional structure. We have re-curated previous entries to purge DisProt from conflicting cases, and also upgraded the functional classification scheme to reflect continuous advance in the field in the past 10 years or so. We define IDPs as proteins that are disordered along their entire sequence, i.e. entirely lack structural elements, and IDRs as regions that are at least five consecutive residues without well-defined structure. We base our assessment of disorder strictly on experimental evidence, such as X-ray crystallography and nuclear magnetic resonance ( primary techniques) and a broad range of other experimental approaches (secondary techniques). Confident and ambiguous annotations are highlighted separately. DisProt 7.0 presents classified knowledge regarding the experimental characterization and functional annotations of IDPs/IDRs, and is intended to provide an invaluable resource for the research community for a better understanding structural disorder and for developing better computational tools for studying disordered proteins.

  • 50. Punta, Marco
    et al.
    Coggill, Penny C.
    Eberhardt, Ruth Y.
    Mistry, Jaina
    Tate, John
    Boursnell, Chris
    Pang, Ningze
    Forslund, Kristoffer
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Ceric, Goran
    Clements, Jody
    Heger, Andreas
    Holm, Liisa
    Sonnhammer, Erik L. L.
    Stockholm University, Faculty of Science, Department of Biochemistry and Biophysics. Stockholm University, Science for Life Laboratory (SciLifeLab).
    Eddy, Sean R.
    Bateman, Alex
    Finn, Robert D.
    The Pfam protein families database2012In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 40, no D1, p. D290-D301Article in journal (Refereed)
    Abstract [en]

    Pfam is a widely used database of protein families, currently containing more than 13 000 manually curated protein families as of release 26.0. Pfam is available via servers in the UK (, the USA ( and Sweden ( Here, we report on changes that have occurred since our 2010 NAR paper (release 24.0). Over the last 2 years, we have generated 1840 new families and increased coverage of the UniProt Knowledgebase (UniProtKB) to nearly 80%. Notably, we have taken the step of opening up the annotation of our families to the Wikipedia community, by linking Pfam families to relevant Wikipedia pages and encouraging the Pfam and Wikipedia communities to improve and expand those pages. We continue to improve the Pfam website and add new visualizations, such as the 'sunburst' representation of taxonomic distribution of families. In this work we additionally address two topics that will be of particular interest to the Pfam community. First, we explain the definition and use of family-specific, manually curated gathering thresholds. Second, we discuss some of the features of domains of unknown function (also known as DUFs), which constitute a rapidly growing class of families within Pfam.

12 1 - 50 of 63
CiteExportLink to result list
Permanent link
Citation style
  • apa
  • ieee
  • modern-language-association-8th-edition
  • vancouver
  • Other style
More styles
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf