Change search
Refine search result
12 1 - 50 of 92
CiteExportLink to result list
Permanent link
Citation style
  • apa
  • ieee
  • modern-language-association-8th-edition
  • vancouver
  • Other style
More styles
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf
Rows per page
  • 5
  • 10
  • 20
  • 50
  • 100
  • 250
  • Standard (Relevance)
  • Author A-Ö
  • Author Ö-A
  • Title A-Ö
  • Title Ö-A
  • Publication type A-Ö
  • Publication type Ö-A
  • Issued (Oldest first)
  • Issued (Newest first)
  • Created (Oldest first)
  • Created (Newest first)
  • Last updated (Oldest first)
  • Last updated (Newest first)
  • Disputation date (earliest first)
  • Disputation date (latest first)
  • Standard (Relevance)
  • Author A-Ö
  • Author Ö-A
  • Title A-Ö
  • Title Ö-A
  • Publication type A-Ö
  • Publication type Ö-A
  • Issued (Oldest first)
  • Issued (Newest first)
  • Created (Oldest first)
  • Created (Newest first)
  • Last updated (Oldest first)
  • Last updated (Newest first)
  • Disputation date (earliest first)
  • Disputation date (latest first)
The maximal number of hits you can export is 250. When you want to export more records please use the Create feeds function.
  • 1. Aidas, Kestutis
    et al.
    Agren, Hans
    Kongsted, Jacob
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Applied Environmental Science (ITM).
    Mocci, Francesca
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    A quantum mechanics/molecular dynamics study of electric field gradient fluctuations in the liquid phase. the case of na+ in aqueous solution2013In: Physical Chemistry, Chemical Physics - PCCP, ISSN 1463-9076, E-ISSN 1463-9084, Vol. 15, no 5, p. 1621-1631Article in journal (Refereed)
    Abstract [en]

    The Na-23 quadrupolar coupling constant of the Na+ ion in aqueous solution has been predicted using molecular dynamics simulations and hybrid quantum mechanics/molecular mechanics methods for the calculation of electric field gradients. The developed computational approach is generally expected to provide reliable estimates of the quadrupolar coupling constants of monoatomic species in condensed phases, and we show here that intermolecular polarization and non-electrostatic interactions are of crucial importance as they result in a 100% increased quadrupolar coupling constant of the ion as compared to a simpler pure electrostatic picture. These findings question the reliability of the commonly applied classical Sternheimer approximation for the calculations of the electric field gradient. As it can be expected from symmetry considerations, the quadrupolar coupling constants of the 5- and 6-coordinated Na+ ions in solution are found to differ significantly.

  • 2. Atzori, Alessio
    et al.
    Liggi, Sonia
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). University of Cagliari, Italy.
    Porcu, Massimiliano
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Università di Cagliari, Italy.
    Lyubartsev, Alexander P.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Saba, Giuseppe
    Mocci, Francesca
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). Università di Cagliari, Italy.
    Base sequence specificity of counterion binding to DNA: what can MD simulations tell us?2016In: Canadian journal of chemistry (Print), ISSN 0008-4042, E-ISSN 1480-3291, Vol. 94, no 12, p. 1181-1188Article in journal (Refereed)
    Abstract [en]

    Nucleic acids are highly charged biopolymers whose secondary structure is strongly dependent on electrostatic interactions. Solvent molecules and ions are also believed to play an important role in mediating and directing both sequence recognition and interactions with other molecules, such as proteins and a variety of ligands. Therefore, to fully understand the biological functions of DNA, it is necessary to understand the interactions with the surrounding counterions. It is well known that monovalent counterions can bind to the minor groove of DNA with consecutive sequences of four, or more, adenine and thymine (A-tracts) with relatively long residence times. However, much less is known about their binding to the backbone and to the major groove. In this work, we used molecular dynamics simulations to both investigate the interactions between the backbone and major groove of DNA and one of its physiological counterions (Na+) and evaluate the relationship between these interactions and the nucleotide sequence. Three dodecamers, namely CGAAAATTTTCG, CGCTCTAGAGCG, and CGCGAATTCGCG, were simulated using the Toukan-Rahman flexible SPC water model and Smith and Dang parameters for Na+, revealing a significant sequence dependence on the ion binding to both backbone and major groove. In the absence of experimental data on the atomistic details of the studied interactions, the reliability of the results was evaluated performing the simulations with additional sets of potential parameters for ions and solvent, namely the A. qvist or the Joung and Cheatham ion parameters and the TIP3P water model. This allowed us to evaluate the results by verifying which features are preserved independently from the parameters adopted.

  • 3. Benetis, Nikolas P.
    et al.
    Dmitriev, Yurij
    Mocci, Francesca
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Rotation Dynamics Do Not Determine the Unexpected Isotropy of Methyl Radical EPR Spectra2015In: Journal of Physical Chemistry A, ISSN 1089-5639, E-ISSN 1520-5215, Vol. 119, no 35, p. 9385-9404Article in journal (Refereed)
    Abstract [en]

    A simple first-principles electronic structure computation, further qc (quantum chemistry) computation, of the methyl radical gives three equal hf (hyperfine) couplings for the three protons with the unpaired electron. The corresponding dipolar tensors were notably rhombic and had different orientations and regular magnitude components, as they should, but what the overall A-tensor was seen by the electron spin is a different story! The final g = (2.002993, 2.002993, 2.002231) tensor and the hf coupling results obtained in vacuum, at the B3LYP/EPRIII level of theory clearly indicate that in particular the above A = (-65.19, -65.19, 62.54) MHz tensor was axial to a first approximation without considering any rotational dynamics for the CH3. This approximation was not applicable, however, for the trifluoromethyl CF3 radical, a heavier and nonplanar rotor with very anisotropic hf coupling, used here for comparison. Finally, a derivation is presented explaining why there is actually no need for the CH3 radicals to consider additional rotational dynamics in order for the electron to obtain an axially symmetric hf (hyperfine) tensor by considering the simultaneous dipolar couplings of the three protons. An additional consequence is an almost isotropic A-tensor for the electron spin of the CH3 radical. To the best of our knowledge, this point has not been discussed in the literature before. The unexpected isotropy of the EPR parameters of CH3 was solely attributed to the rotational dynamics and was not clearly separated from the overall symmetry of the species. The present theoretical results allowed a first explanation of the forbidden satellite lines in the CH3 EPR spectrum. The satellites are a fingerprint of the radical rotation, helping thus in distinguishing the CH3 reorientation from quantum rotation at very low temperatures.

  • 4.
    Cheung, Ocean
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Materials Chemistry.
    Bacsik, Zoltán
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Materials Chemistry.
    Krokidas, Panagiotis
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Materials Chemistry.
    Mace, Amber
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Hedin, Niklas
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Materials Chemistry.
    K+ Exchanged Zeolite ZK-4 as a Highly Selective Sorbent for CO22014In: Langmuir, ISSN 0743-7463, E-ISSN 1520-5827, Vol. 30, no 32, p. 9682-9690Article in journal (Refereed)
    Abstract [en]

    Adsorbents with high capacity and selectivity for adsorption of CO2 are currently being investigated for applications in adsorption-driven separation of CO2 from flue gas. An adsorbent with a particularly high CO2-over-N-2 selectivity and high capacity was tested here. Zeolite ZK-4 (Si:Al similar to 1.3:1), which had the same structure as zeolite A (LTA), showed a high CO2 capacity of 4.85 mmol/g (273 K, 101 kPa) in its Na+ form. When approximately 26 at % of the extraframework cations were exchanged for K+ (NaK-ZK-4), the material still adsorbed a large amount of CO2 (4.35 mmol/g, 273 K, 101 kPa), but the N-2 uptake became negligible (<0.03 mmol/g, 273 K, 101 kPa). The majority of the CO2 was physisorbed on zeolite ZK-4 as quantified by consecutive volumetric adsorption measurements. The rate of physisorption of CO2 was fast, even for the highly selective sample. The molecular details of the sorption of CO2 were revealed as well. Computer modeling (Monte Carlo, molecular dynamics simulations, and quantum chemical calculations) allowed us to partly predict the behavior of fully K+ exchanged zeolite K-ZK-4 upon adsorption of CO2 and N-2 for Si:Al ratios up to 4:1. Zeolite K-ZK-4 with Si:Al ratios below 23:1 restricted the diffusion of CO2 and N-2 across the cages. These simulations could not probe the delicate details of the molecular sieving of CO2 over N-2. Still, this study indicates that zeolites NaK-ZK-4 and K-ZK-4 could be appealing adsorbents with high CO2 uptake (similar to 4 mmol/g, 101 kPa, 273 K) and a kinetically enhanced CO2-over-N-2 selectivity.

  • 5.
    Dahlberg, M
    et al.
    Stockholm University.
    Laaksonen, A
    Stockholm University.
    Preferential solvation of phenol in binary solvent mixtures. A molecular dynamics study2006In: Journal of Physical Chemistry A, Vol. 110, p. 2253-2258Article in journal (Refereed)
  • 6. Dong, Yihui
    et al.
    Ji, Xiaoyan
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Nanjing Tech University, China; Uppsala University, Sweden; Petru Poni Institute of Macromolecular Chemistry, Romania.
    Cao, Wei
    An, Rong
    Lu, Linghong
    Lu, Xiaohua
    Determination of the small amount of proteins interacting with TiO2 nanotubes by AFM-measurement2019In: Biomaterials, ISSN 0142-9612, E-ISSN 1878-5905, Vol. 192, p. 368-376Article in journal (Refereed)
    Abstract [en]

    Detecting the small amounts of proteins interacting effectively with the solid film electrodes surface still remains a challenge. To address this, in this work, a new approach was proposed by the combination of the adhesion forces and the molecular interaction measured with AFM. Cytochrome c (Cyt C) interacting effectively with TiO2 nanotube arrays (TNAs) was chosen as a probe. The amounts of Cyt C molecules interacting effectively on TNAs surface (C-TNA) range from 5.5x10(-12) to 7.0x10(-12) mol/cm(2) (68.2-86.8 ng/cm(2)) and they are comparable with the values obtained by the electrochemistry method in the literature, in evidence of the accuracy of this AFM-based approach. The reliability of the proposed approach was further verified by conducting Surface Enhanced Raman Scattering (SERS) measurements and estimating the enhancement factor (EF). This interaction-based AFM approach can be used to accurately obtain the small amounts of adsorbed substances on the solid film electrodes surface in the applications such as biosensors, biocatalysis, and drug delivery, etc.

  • 7. Dong, Yihui
    et al.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Nanjing Tech University, China; Petru Poni Institute of Macromolecular Chemistry, Romania.
    Cao, Wei
    Ji, Xiaoyan
    Lu, Xiaohua
    AFM Study of pH-Dependent Adhesion of Single Protein to TiO2 Surface2019In: Advanced Materials Interfaces, ISSN 2196-7350, Vol. 6, no 14, article id 1900411Article in journal (Refereed)
    Abstract [en]

    The effect of pH-induced electrostatic conditions on the molecular interaction force of a single lysozyme molecule with TiO2 is investigated using atomic force microscopy (AFM). The force between the charged or neutral lysozyme molecule and the TiO2 surface is measured at different pH from 3.6 to 10.8. It is found to be directly proportional to the contact area, given by an effective diameter of the lysozyme molecule, and is further qualitatively verified by the AFM-measured friction coefficients. The results of the Derjaguin-Landau-Verwey-Overbeek theory show that the pH can change the surface charge densities of both lysozyme and TiO2, but the molecular interaction force at different pH is only dependent on the pH-induced effective diameter of lysozyme. The molecular interaction forces, quantified at the nanoscale, can be directly used to design high-performance liquid chromatography measurements at macroscale by tuning the retention time of a protein under varied pH conditions. They can also be applied to develop a model for predicting and controlling the chromatographic separations of proteins.

  • 8. Egorov, A. V.
    et al.
    Brodskaya, E. N.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Uppsala University, Sweden.
    The Effect of Single-Atomic Ions on the Melting of Microscopic Ice Particles According to Molecular Dynamics Data2018In: Colloid Journal of the Russian Academy of Science, ISSN 1061-933X, E-ISSN 1608-3067, Vol. 80, no 5, p. 484-491Article in journal (Refereed)
    Abstract [en]

    Molecular dynamics simulation of microscopic ice particles containing Ca2+, F-, Cl-, Na+, and Li+ ions has been performed in the temperature range of 20-200 K. For all the systems under consideration, phase and structural transformations accompanying their heating have been studied in detail, and the melting points have been determined. The main attention has been focused on the determination of the mechanisms of the effect of ions on the phase state of microcrystals.

  • 9. Egorov, Andrei V.
    et al.
    Lyubartsev, Alexander P.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Molecular Dynamics Simulation Study of Glycerol-Water Liquid Mixtures2011In: Journal of Physical Chemistry B, ISSN 1520-6106, E-ISSN 1520-5207, Vol. 115, no 49, p. 14572-14581Article in journal (Refereed)
    Abstract [en]

    To study the effects of water on conformational dynamics of polyalcohols, Molecular Dynamics simulations of glycerol water liquid mixtures have been carried out at different concentrations: 42.9 and 60.0 wt 96 of glycerol, respectively. On the basis of the analysis of backbone conformer distributions, it is found that the surrounding water molecules have a large impact on the populations of the glycerol conformers. While the local structure of water in the liquid mixture is surprisingly close to that in pure liquid water, the behavior of glycerols can be divided into three different categories where roughly 25% of them occur in a structure similar to that in pure liquid of glycerol, ca. 25% of them exist as monomers, solvated by water, and the remaining 50% of glycerols in the mixture form H-bonded strings as. remains of the glycerol H-bond network. The typical glycerol H-bond network still exists even at the lower concentration of 40 wt % of glycerol. The microheterogeneity of water glycerol mixtures is analyzed using time-averaged distributions of the sizes of the water aggregates. At 40 wt % of glycerol, the cluster sizes from 3 to 10 water molecules are observed. The increase of glycerol content causes a depletion of clusters leading to smaller 3-5 molecule clusters domination. Translational diffusion coefficients have been calculated to study the dynamical behavior of both glycerol and water molecules. Rotational-reorientational motion is studied both in overall and in selected substructures on the basis of time correlation functions. Characteristic time scales for different motional modes are deduced on the basis of the calculated correlation times. The general conclusion is that the presence of water increases the overall mobility of glycerol, while glycerol slows the mobility of water.

  • 10. Egorov, AV
    et al.
    Komolkin, AV
    Lyubartsev, AP
    Laaksonen, A
    Stockholm University.
    First and second hydration shell of Ni2+ studied by molecular dynamics simulations2006In: Theoretical Chemistry Accounts, Vol. 115, p. 170-176Article in journal (Refereed)
  • 11.
    Engelbrecht, Leon
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stellenbosch University, South Africa; University of Cagliari, Italy.
    Mocci, Francesca
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Uppsala University, Sweden.
    Koch, Klaus R.
    Pt-195 NMR and Molecular Dynamics Simulation Study of the Solvation of [PtCl6](2-) in Water-Methanol and Water-Dimethoxyethane Binary Mixtures2018In: Inorganic Chemistry, ISSN 0020-1669, E-ISSN 1520-510X, Vol. 57, no 19, p. 12025-12037Article in journal (Refereed)
    Abstract [en]

    The experimental Pt-195 NMR chemical shift, delta((195) Pt), of the [PtCl6](2-) anion dissolved in binary mixtures of water and a fully miscible organic solvent is extremely sensitive to the composition of the mixture at room temperature. Significantly nonlinear delta(Pt-195) trends as a function of solvent composition are observed in mixtures of water-methanol, or ethylene glycol, 2methoxyethanol, and 1,2-dimethoxyethane (DME). The extent of the deviation from linearity of the delta((195) Pt) trend depends strongly on the nature of the organic component in these solutions, which broadly suggests preferential solvation of the [PtCl6](2-) anion by the organic molecule. This simplistic interpretation is based on an accepted view pertaining to monovalent cations in similar binary solvent mixtures. To elucidate these phenomena in detail, classical molecular dynamics computer simulations were performed for [PtCl6](2-) in water-methanol and water-DME mixtures using the anionic charge scaling approach to account for the effect of electronic dielectric screening. Our simulations suggest that the simplistic model of preferential solvation of [PtCl6](2-) by the organic component as inferred from nonlinear delta(Pt-195) trends is not entirely accurate, particularly for water-DME mixtures. The delta(Pt-195) trend in these mixtures levels off for high DME mole fractions, which results from apparent preferential location of [PtCl6](2-) anions at the borders of water-rich regions or clusters within these inherently micro-heterogeneous mixtures. By contrast in water-methanol mixtures, apparently less pronounced mixed solvent micro-heterogeneity is found, suggesting the experimental delta(Pt-195) trend is consistent with a more moderate preferential solvation of [PtCl6](2-) anions. This finding underlines the important role of solvent-solvent interactions and micro-heterogeneity in determining the solvation environment of [PtCl6](2-) anions in binary solvent mixtures, probed by highly sensitive Pt-195 NMR. The notion that preferential solvation of [PtCl6](2-) results primarily from competing ion-solvent interactions as generally assumed for monatomic ions, may not be appropriate in general.

  • 12.
    Fossépré, Mathieu
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). University of Namur (UNamur), Belgium.
    Leherte, Laurence
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Vercauteren, Daniel P.
    Multiscale design of coarse-grained elastic network-based potentials for the mu opioid receptor2016In: Journal of Molecular Modeling, ISSN 1610-2940, E-ISSN 0948-5023, Vol. 22, no 9, article id 227Article in journal (Refereed)
    Abstract [en]

    Despite progress in computer modeling, most biological processes are still out of reach when using all-atom (AA) models. Coarse-grained (CG) models allow classical molecular dynamics (MD) simulations to be accelerated. Although simplification of spatial resolution at different levels is often investigated, simplification of the CG potential in itself has been less common. CG potentials are often similar to AA potentials. In this work, we consider the design and reliability of purely mechanical CG models of the mu opioid receptor (mu OR), a G protein-coupled receptor (GPCR). In this sense, CG force fields (FF) consist of a set of holonomic constraints guided by an elastic network model (ENM). Even though ENMs are used widely to perform normal mode analysis (NMA), they are not often implemented as a single FF in the context of MD simulations. In this work, various ENM-like potentials were investigated by varying their force constant schemes and connectivity patterns. A method was established to systematically parameterize ENM-like potentials at different spatial resolutions by using AA data. To do so, new descriptors were introduced. The choice of conformation descriptors that also include flexibility information is important for a reliable parameterization of ENMs with different degrees of sensitivity. Hence, ENM-like potentials, with specific parameters, can be sufficient to accurately reproduce AA MD simulations of mu OR at highly coarse-grained resolutions. Therefore, the essence of the flexibility properties of mu OR can be captured with simple models at different CG spatial resolutions, opening the way to mechanical approaches to understanding GPCR functions.

  • 13.
    Fossépré, Mathieu
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry. University of Namur (UNamur), Belgium.
    Leherte, Laurence
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry. Stellenbosch University, South Africa.
    Vercauteren, Daniel P.
    On the Modularity of the Intrinsic Flexibility of the mu Opioid Receptor: A Computational Study2014In: PLoS ONE, ISSN 1932-6203, E-ISSN 1932-6203, Vol. 9, no 12, p. e115856-Article in journal (Refereed)
    Abstract [en]

    The mu opioid receptor (mu OR), the principal target to control pain, belongs to the G protein-coupled receptors (GPCRs) family, one of the most highlighted protein families due to their importance as therapeutic targets. The conformational flexibility of GPCRs is one of their essential characteristics as they take part in ligand recognition and subsequent activation or inactivation mechanisms. It is assessed that the intrinsic mechanical properties of the mu OR, more specifically its particular flexibility behavior, would facilitate the accomplishment of specific biological functions, at least in their first steps, even in the absence of a ligand or any chemical species usually present in its biological environment. The study of the mechanical properties of the mu OR would thus bring some indications regarding the highly efficient ability of the mu OR to transduce cellular message. We therefore investigate the intrinsic flexibility of the mu OR in its apo-form using all-atom Molecular Dynamics simulations at the sub-microsecond time scale. We particularly consider the mu OR embedded in a simplified membrane model without specific ions, particular lipids, such as cholesterol moieties, or any other chemical species that could affect the flexibility of the mu OR. Our analyses highlighted an important local effect due to the various bendability of the helices resulting in a diversity of shape and volume sizes adopted by the mu OR binding site. Such property explains why the mu OR can interact with ligands presenting highly diverse structural geometry. By investigating the topology of the mu OR binding site, a conformational global effect is depicted: the correlation between the motional modes of the extra-and intracellular parts of mu OR on one hand, along with a clear rigidity of the central mu OR domain on the other hand. Our results show how the modularity of the mu OR flexibility is related to its preability to activate and to present a basal activity.

  • 14.
    Golets, Mikhail
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Shimpi, M. R.
    Wang, Y. -L.
    Antzutkin, O. N.
    Glavatskih, S.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stellenbosch University, South Africa.
    Understanding the thermal decomposition mechanism of a halogen-free chelated orthoborate-based ionic liquid: a combined computational and experimental study2016In: Physical Chemistry, Chemical Physics - PCCP, ISSN 1463-9076, E-ISSN 1463-9084, Vol. 18, no 32, p. 22458-22466Article in journal (Refereed)
    Abstract [en]

    In the last few decades, ionic liquids (ILs) have gained significant attention as lubricants and lubricant additives due to their polar nature, low vapour pressure and tunable physicochemical properties. In this work, quantum chemistry calculations and atomistic Molecular Dynamics (MD) simulations were employed to predict thermal degradation mechanisms of a potential lubricating agent - the tributyloctylphosphonium bis(oxalato) borate ([P-4,P-4,P-4,P-8][BOB]) IL. It was found that the onset of decomposition of the studied IL coincides with a cleavage of the B-O bonds in the [BOB](-) anion. Consequently, a series of chemical reactions of the [P-4,P-4,P-4,P-8](+) cation with the [BOB](-) anion was triggered yielding alkylboranes, alkenes, trialkylphosphines, CO and CO2. Another ionic system, consisting of [P-4,P-4,P-4,P-8][Cl], was also tested for a comparison. Thermogravimetric measurements have shown a higher thermal stability of [P-4,P-4,P-4,P-8][BOB] compared to that of [P-4,P-4,P-4,P-8][Cl] at least at the initial stage of decomposition, in accord with the presented calculations. Quantum chemical frequency calculations also agreed with the experimental Fourier Transform Infrared (FTIR) spectroscopy results.

  • 15.
    Hedin, Niklas
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Chen, LiJun
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Sorbents for CO2 capture from flue gas—aspects from materials and theoretical chemistry2010In: Nanoscale, ISSN 2040-3364, Vol. 2, no 10, p. 1819-1841Article in journal (Refereed)
    Abstract [en]

    Predictions of future climate change have triggered a search for ways to reduce the release of greenhouse gases into the atmosphere. Carbon capture and storage (CCS) assists this goal by reducing carbon dioxide emissions, and CO2 adsorbents in particular can reduce the costs of CO2 capture. Here, we review the nanoscale sorbent materials that have been developed and the theoretical basis for their function in CO2 separation, particularly from N2-rich flue gases.

  • 16.
    Hedman, Fredrik
    et al.
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Ewald Summation Based on Nonuniform Fast Fourier Transform2006In: Chemical Physics Letters, ISSN 0009-2614, E-ISSN 1873-4448, Vol. 425, no 1-3, p. 142-147Article in journal (Refereed)
    Abstract [en]

    We present a novel approach, that combines the traditional Ewald summation technique with the nonuniform Fast Fourier transform to calculate the electrostatic energies and forces in molecular computer simulations. The method can easily be implemented in existing simulation programs. We report here some results from our implementation, where we utilize widely available libraries, and demonstrate the accuracy, and expected computational complexity of our approach.

  • 17.
    Ibarra, Ilich A.
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Universidad Nacional Autónoma de México, Mexico.
    Mace, Amber
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Yang, Sihai
    Sun, Junliang
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Lee, Sukyung
    Chang, Jong-San
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Schröder, Martin
    Zou, Xiaodong
    Adsorption Properties of MFM-400 and MFM-401 with CO2 and Hydrocarbons: Selectivity Derived from Directed Supramolecular Interactions2016In: Inorganic Chemistry, ISSN 0020-1669, E-ISSN 1520-510X, Vol. 55, no 15, p. 7219-7228Article in journal (Refereed)
    Abstract [en]

    ([Sc-2(OH)(2)(BPTC)]) (H4BPTC = biphenyl-3,3',5,5'-tetracarboxylit acid), MFM-400 (MFM = Manchester Framework Material; previously designated NOTT), and ([Sc(OH)-(TDA)]) (H(2)TDA = thiophene-2,5-dicarboxylic acid), MFM-401, both show xelective and, reversible capture of CO2. In particular, MFM-400 exhibits a reasonably high CO2 uptake at low pressures and competitive CO2/N-2 selectivity coupled to a moderate isosteric heat of adsorption (Q(st)) for CO2 (29.5 kJ mol(-1)) at zero coverage, thus affording a facile uptake release process. Grand canonical Monte Carlo (GCMC) and density functional theory (DFT) computational analyses of CO2 uptake in both materials confirmed preferential adsorption sites consistent with the higher CO2 uptake observed experimentally for MFM-400 over MFM-401 at low pressures. For MFM-400, the Sc-OH group participates in moderate interactions with CO2 (Q(st) = 33.5 kJ mol(-1)), and these are complemented by weak hydrogen-bonding interactions (O center dot center dot center dot H-C = 3.10-3.22 angstrom) from four surrounding aromatic -CH groups. In the case of MFM-401, adsorption is provided by cooperative interactions of CO2 with the Sc-OH group and one C-H group. The binding energies obtained by DFT analysis for the adsorption sites for both materials correlate well with the observed moderate isosteric heats of adsorption for CO2. GCMC simulations for both materials confirmed higher uptake of EtOH compared with nonpolar vapors of toluene and. cydohexane. This is in good Correlation with the experimental data, and DFT analysis confirmed the formation of a strong hydrogen bond between EtOH and the hydrogen atom of the hydroxyl group of the MFM-400 and MFM-401 framework (FIAT) with H-O-EtOH center dot center dot center dot H-O-FW distances of 1.77 arid 1.75 angstrom, respectively. In addition, the accessible regeneration of MFM-400 and MFM-401 and release of CO2 potentially provide minimal economic and environmental penalties.

  • 18. Isac, Dragos Lucian
    et al.
    Airinei, Anton
    Maftei, Dan
    Humelnicu, Ionel
    Mocci, Francesca
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Petru Poni Institute of Macromolecular Chemistry, Romania.
    Pinteala, Mariana
    On the Charge-Transfer Excitations in Azobenzene Maleimide Compounds: A Theoretical Study2019In: Journal of Physical Chemistry A, ISSN 1089-5639, E-ISSN 1520-5215, Vol. 123, no 26, p. 5525-5536Article in journal (Refereed)
    Abstract [en]

    Photoswitchable systems with charge-transfer (CT) transitions have gained much attention during the recent years because of their many emerging applications. CT transitions themselves are of fundamental importance from physical, chemical, engineering, and molecular modeling points of view because they depend on the modified intramolecular electronic structure. CT transitions in azobenzene (AB) were observed when substituted with the maleimide (MI) functional group. This work represents a systematic theoretical study of excited states of the AB MI structures of eight azo derivatives. In addition to the two main azo transitions (pi -> pi* and n -> pi*), our calculations show a CT occurring between the azo moiety as a donor and the MI group as an acceptor. The CT mechanism can be characterized based on both the number and the position of the MI fragments. MI groups in the azo structure result in low-energy transitions, changing the order of the main transitions by introducing a CT character. Calculations using both density functional theory (DFT) and high-end molecular orbital theories confirm the CT character of these derivatives, although the order of excited states was found to differ depending on the chosen level of theory. We present here the first theoretical investigation of the electronic excited states (n pi*CT and pi pi*CT) and corresponding transitions for this class of compounds. The computational results showed that the CT mechanism in AB MI derivatives can occur via two pathways: planar and twisted. Our findings are expected to be of substantial interest, especially in the area of molecular optoelectronics and in the design of responsive materials.

  • 19. Jesudason, C.G.
    et al.
    Lyubartsev, Alexander
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Conformational characteristics of single flexible polyelectrolyte chain2009In: The European Physical Journal E Soft matter, ISSN 1292-8941, E-ISSN 1292-895X, Vol. 30, p. 341-350Article in journal (Refereed)
    Abstract [en]

    The behavior of a flexible anionic chain of 150 univalent and negatively charged beads connected by harmonic-like potential interactions with each other in the presence of equal number of positive and free counterions, observed in molecular dynamics simulations with Langevin thermostat, is described in a temperature range from 0.1 to 10.0 in reduced units. The total and Coulombic energies, radial distribution functions, radii of gyration, end-to-end distances of the chain are depicted. Our results turned out to be qualitatively similar to the results obtained earlier for a lattice polyelectrolyte model, including temperature maximum of the polyelectrolyte chain and internal phase transition which seems to occur abruptly at low temperatures for all the systems studied, judging from the shape of end-to end distance, gyration radius and energy profiles.

  • 20.
    Jämbeck, Joakim P. M.
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Eriksson, Emma S. E.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Lyubartsev, Alexander P.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Eriksson, Leif A.
    Molecular Dynamics Studies of Liposomes as Carriers for Photosensitizing Drugs: Development, Validation, and Simulations with a Coarse-Grained Model2014In: Journal of Chemical Theory and Computation, ISSN 1549-9618, E-ISSN 1549-9626, Vol. 10, no 1, p. 5-13Article in journal (Refereed)
    Abstract [en]

    Liposomes are proposed as drug delivery systems and can in principle be designed so as to cohere with specific tissue types or local environments. However, little detail is known about the exact mechanisms for drug delivery and the distributions of drug molecules inside the lipid carrier. In the current work, a coarse-grained (CG) liposome model is developed, consisting of over 2500 lipids, with varying degrees of drug loading. For the drug molecule, we chose hypericin, a natural compound proposed for use in photodynamic therapy, for which a CG model was derived and benchmarked against corresponding atomistic membrane bilayer model simulations. Liposomes with 21-84 hypericin molecules were generated and subjected to 10 microsecond simulations. Distribution of the hypericins, their orientations within the lipid bilayer, and the potential of mean force for transferring a hypericin molecule from the interior aqueous droplet through the liposome bilayer are reported herein.

  • 21.
    Jämbeck, Joakim P. M.
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Mocci, Francesca
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Lyubartsev, Alexander P.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Partial Atomic Charges and Their Impact on the Free Energy of Solvation2013In: Journal of Computational Chemistry, ISSN 0192-8651, E-ISSN 1096-987X, Vol. 34, no 3, p. 187-197Article in journal (Refereed)
    Abstract [en]

    Free energies of solvation (Delta G) in water and n-octanol have been computed for common drug molecules by molecular dynamics simulations with an additive fixed-charge force field. The impact of the electrostatic interactions was investigated by computing the partial atomic charges with four methods that all fit the charges from the quantum mechanically determined electrostatic potential (ESP). Due to the redistribution of electron density that occurs when molecules are transferred from gas phase to condensed phase, the polarization impact was also investigated. By computing the partial atomic charges with the solutes placed in a conductor-like continuum, the charges were effectively polarized to take the polarization effects into account. No polarization correction term or similar was considered, only the partial atomic charges. Results show that free energies are very sensitive to the choice of atomic charges and that Delta G can differ by several k(B)T depending on the charge computing method. Inclusion of polarization effects makes the solutes too hydrophilic with most methods and in vacuo charges make the solutes too hydrophobic. The restrained-ESP methods together with effectively polarized charges perform well in our test set and also when applied to a larger set of molecules. The effect of water models is also highlighted and shows that the conclusions drawn are valid for different three-point models. Partitioning between an aqueous and a hydrophobic phase is also described better if the two environment's polarization is taken into account, but again the results are sensitive to the charge calculation method. Overall, the results presented here show that effectively polarized charges can improve the description of solvating a drug-like molecule in a solvent and that the choice of partial atomic charges is crucial to ensure that molecular simulations produce reliable results.

  • 22.
    Laaksonen, Aatto
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Lyubartsev, Alexander
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Mocci, Francesca
    Cagliary University, Italy.
    M.DynaMix Studies of Solvation, Solubility and Permeability2012In: Molecular Dynamics - Studies of Synthetic and Biological Macromolecules / [ed] Lichang Wang, InTech, 2012, p. 85-106Chapter in book (Refereed)
  • 23. Larin, Alexander V.
    et al.
    Mace, Amber
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Rybakov, Andrey A.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Carbonate "door" in the NaKA zeolite as the reason of higher CO2 uptake relative to N-22012In: Microporous and Mesoporous Materials, ISSN 1387-1811, E-ISSN 1873-3093, Vol. 162, p. 98-104Article in journal (Refereed)
    Abstract [en]

    Theoretical calculations are performed on a model zeolite A where sodium ions have successively been exchanged with potassium. Using both isolated cluster and periodic DFT calculations, we made an attempt to explain how the chemisorbed carbonate species in the material contribute to the exceptionally high CO2 over N-2 selectivity of nearly 200 found in recent experiments [Liu et al. [1]] with the zeolite NaKA as adsorbent to capture and separate carbon dioxide from a gas mixture containing nitrogen. We have shown that the high carbonate forming at the potassium positions in the 8R windows (KII) results in a larger 8R window diameter potentially enhancing the CO2 uptake if adsorption is measured for individual gases.

  • 24. Larin, Alexander V.
    et al.
    Rybakov, Andrey A.
    Zhidomirov, Georgii M.
    Mace, Amber
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Vercauteren, Daniel P.
    Oxide clusters as source of the third oxygen atom for the formation of carbonates in alkaline earth dehydrated zeolites2011In: Journal of Catalysis, ISSN 0021-9517, E-ISSN 1090-2694, Vol. 281, no 2, p. 212-221Article in journal (Refereed)
    Abstract [en]

    In our paper, we show that carbonates can be formed with almost no energetic barrier from CO(2) and metal-oxide binuclear MO(x)M species (M = Mg, Ca, Sr, Ba, with X = 1-4, depending on the cation) in alkaline earth zeolites, mordenite (MOR) and phillipsite (PHI), on the basis of quantum mechanical density functional theory (DFT) calculations at both isolated cluster and 3D periodic levels. The participation of MO(x)M species (X = 1 and 3) explains the source of the third O atom in CO(3) species in dehydrated zeolites, on the basis of a good agreement between the calculated and experimental positions of the asymmetric and symmetric CO(3) vibration bands, of the ratio of their intensities, and of the weak dependence versus the cation and framework type. The reaction of formation of dimethylcarbonate from CaCO(3)Ca in the 8-membered (8R) ring of MOR and methanol has also been considered, suggesting the carbonate activity as the source of CO(2) at elevated temperatures.

  • 25. Law, Christopher J.
    et al.
    Almqvist, Jonas
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Bernstein, Adam
    Goetz, Regina M.
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Huang, Yafei
    Soudant, Celine
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Hovmöller, Sven
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Wang, Da-Neng
    Salt-bridge dynamics control substrate-induced conformational change in the membrane transporter GlpT2008In: Journal of Molecular Biology, ISSN 0022-2836, E-ISSN 1089-8638, Vol. 378, no 4, p. 828-839Article in journal (Refereed)
    Abstract [en]

    Active transport of substrates across cytoplasmic membranes is of great physiological, medical and pharmaceutical importance. The glycerol-3-phosphate (G3P) transporter (GlpT) of the E. coli inner membrane is a secondary active antiporter from the ubiquitous major facilitator superfamily that couples the import of G3P to the efflux of inorganic phosphate (Pi) down its concentration gradient. Integrating information from a novel combination of structural, molecular dynamics simulations and biochemical studies, we identify the residues involved directly in binding of substrate to the inward-facing conformation of GlpT, thus defining the structural basis for the substrate-specificity of this transporter. The substrate binding mechanism involves protonation of a histidine residue at the binding site. Furthermore, our data suggest that the formation and breaking of inter- and intradomain salt bridges control the conformational change of the transporter that accompanies substrate translocation across the membrane. The mechanism we propose may be a paradigm for organophosphate:phosphate antiporters.

  • 26. Liang, Shuai
    et al.
    Hall, Kyle Wm.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Uppsala University, Sweden; Petru Poni Institute of Macromolecular Chemistry, Romania.
    Zhang, Zhengcai
    Kusalik, Peter G.
    Characterizing key features in the formation of ice and gas hydrate systems2019In: Philosophical Transactions. Series A: Mathematical, physical, and engineering science, ISSN 1364-503X, E-ISSN 1471-2962, Vol. 377, no 2146, article id 20180167Article, review/survey (Refereed)
    Abstract [en]

    Crystallization in liquids is critical to a range of important processes occurring in physics, chemistry and life sciences. In this article, we review our efforts towards understanding the crystallization mechanisms, where we focus on theoretical modelling and molecular simulations applied to ice and gas hydrate systems. We discuss the order parameters used to characterize molecular ordering processes and how different order parameters offer different perspectives of the underlying mechanisms of crystallization. With extensive simulations of water and gas hydrate systems, we have revealed unexpected defective structures and demonstrated their important roles in crystallization processes. Nucleation of gas hydrates can in most cases be characterized to take place in a two-step mechanism where the nucleation occurs via intermediate metastable precursors, which gradually reorganizes to a stable crystalline phase. We have examined the potential energy landscapes explored by systems during nucleation, and have shown that these landscapes are rugged and funnel-shaped. These insights provide a new framework for understanding nucleation phenomena that has not been addressed in classical nucleation theory. This article is part of the theme issue 'The physics and chemistry of ice: scaffolding across scales, from the viability of life to the formation of planets'.

  • 27. Lindgren, Matteus
    et al.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Westlund, Per-Olof
    A theoretical spin relaxation and molecular dynamics simulation study of the Gd(H2O)(9)(3+) complex2009In: Physical Chemistry, Chemical Physics - PCCP, ISSN 1463-9076, E-ISSN 1463-9084, Vol. 11, no 44, p. 10368-10376Article in journal (Refereed)
    Abstract [en]

    A theoretical analysis of the paramagnetically enhanced water proton spin-lattice relaxation of a hydrated Gd3+ ion is combined with  Molecular Dynamics (MD) simulations. The electron-proton dipole-dipole  correlation function, C-p(DD)(tau), as well as the pseudo-rotation ( PR) model of the transient zero-field splitting (ZFS) are evaluated  with the help of the data from MD simulations. The fast local water  motion in the first hydration shell, i.e. the wagging and rocking motions, is found not to change the mono exponential character of the dipole correlation function C-p(DD)(tau), but is important in the time dependence of the transient ZFS interaction. The dynamics of the transient ZFS interaction is modeled as the water-induced electric field gradient tensor at the site of the metal ion. This approach follows the ideas of the pseudo-rotation model, describing the fluctuating zero-field interaction as a constant amplitude in the principal frame but reorienting according to a rotational diffusion equation of motion. The MD results indicate that the pseudo-rotation model gives a multi-exponential correlation function which oscillates at short times and is described by three exponential terms. The time scale is shorter than previously assumed but contain an intermediate time constant (1-2 ps). The electron spin resonance (ESR) spectral width at half height at frequencies of X- band,Q-band, 75 MHz, 150 MHz and 225 MHz can be reproduced at 320 K  without any contributions from 4th or 6th rank ZFS interactions. Consequently,there are two mutually inconsistent dynamic models of the  ZFS interaction which can describe the water proton T-1-NMRD (nuclear  magnetic resonance dispersion) profile and the field dependent ESR spectra of the hydrated Gd(III) complex equally well.

  • 28.
    Liu, Qingling
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Mace, Amber
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Bacsik, Zoltan
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Sun, Junliang
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Hedin, Niklas
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    NaKA sorbents with high CO2-over-N2 selectivity and high capacity to adsorb CO22010In: Chemical Communications, ISSN 1359-7345, E-ISSN 1364-548X, Vol. 46, p. 4502-4504Article in journal (Refereed)
    Abstract [en]

    The uptake of carbon dioxide and nitrogen gas by zeolite NaKA was studied. A very high ideal CO2-over-N2 selectivity and a high CO2 capacity were observed at an optimal K+ content of 17 at.%. NaKA is a very promising adsorbent for CO2 separation from water-free flue gases.

  • 29. Lu, Hui
    et al.
    Tu, Yaoquan
    Lin, Xian
    Fang, Bin
    Luo, Duanbin
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Effects of laser irradiation on the structure and optical properties of ZnO thin films2010In: Materials letters (General ed.), ISSN 0167-577X, E-ISSN 1873-4979, Vol. 64, no 19, p. 2072-2075Article in journal (Refereed)
    Abstract [en]

    The effects of laser irradiation on the surface microstructure and optical properties of ZnO films deposited on glass substrates were investigated experimentally and compared with those of thermal annealing. X-ray diffraction (XRD) and atomic force microscopy (AFM) measurements showed that the irradiation treatment with an Ar+ laser of 514 nm for 5 min improves the crystalline quality of ZnO thin films through increasing the grain size and enhancing the c-axis orientation, with the effects similar to those of the thermal annealing at 500 degrees C for 1 h. Laser irradiation was found to be more effective both for the relaxation of the residual compressive stress in the as-grown films and for the modification of the surface morphology. A significant increase in the UV absorption and a widening in the optical band-gap of the films were also observed after laser irradiation.

  • 30. Lu, Hui
    et al.
    Zheng, Zhi-Jia
    Lin, Xian
    Xu, Fei
    Bi, Han
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Grain growth behavior, surface morphology evolution, structures, and optical properties of ZnO thin films prepared by RF reactive magnetron sputtering2014In: Journal of Optoelectronics and Advanced Materials, ISSN 1454-4164, E-ISSN 1841-7132, Vol. 16, no 1-2, p. 170-175Article in journal (Refereed)
    Abstract [en]

    ZnO thin films were prepared by radio frequency (RF) reactive magnetron sputtering at varying deposition conditions. The effects of RF power (from 40 to 90 W) and substrate temperature (from 100 to 200 degrees C) on the grain growth behavior, surface morphology evolution, and the structural and optical properties of the films were investigated. Atomic force microscopy (AFM) measurements confirmed that the grain size and surface roughness depend mainly on the RF power and increase with increasing it at the initial deposition stage of 5 s, and are strongly affected by the substrate temperature and increase with increasing it at the final deposition stage of 45 min. The influence of both the deposition parameters on the surface structure of the ZnO films at different deposition stages and the mechanism concerning this influence were discussed. The X-ray diffraction (XRD) and optical absorption spectra analysis indicated that all the films deposited for 45 min are in the state of the compressive stress and exhibit polycrystalline nature with the (002) preferential orientation, and they have high optical transparency in the visible range and sharp absorption edges around the wavelength 360 nm corresponding to the ZnO exciton. With the increase of the RF power and substrate temperature, the grain size increases, the residual compressive stress relaxes, and the optical band gaps broaden. In comparison with the RF power, the substrate temperature has more evident influence on the microstructure of the ZnO thin films.

  • 31.
    Lyubartsev, Alexander
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Mirzoev, Alexander
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Chen, Li Jun
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK), Physical Chemistry.
    Systematic coarse-graining of molecular models by the Newton inversion method2010In: Faraday discussions (Online), ISSN 1359-6640, E-ISSN 1364-5498, Vol. 144, p. 43-56Article in journal (Refereed)
    Abstract [en]

    Systematic construction of coarse-grained molecular models from detailed atomistic simulations, and even from ab initio simulations is discussed. Atomistic simulations are first performed to extract structural information about the system, which is then used to determine effective potentials for a coarse-grained model of the same system. The statistical-mechanical equations expressing the canonical properties in terms of potential parameters can be inverted and solved numerically according to the iterative Newton scheme. In our previous applications, known as the Inverse Monte Carlo, radial distribution functions were inverted to reconstruct pair potential, while in a more general approach the targets can be other canonical averages. We have considered several examples of coarse-graining; for the united atom water model we suggest an easy way to overcome the known problem of high pressure. Further, we have developed coarse-grained models for L- and D-prolines, dissolved here in an organic solvent (dimethylsulfoxide), keeping their enantiomeric properties from the corresponding all-atom proline model. Finally, we have revisited the previously developed coarse-grained lipid model based on an updated all-atomic force field. We use this model in large-scale meso-scale simulations demonstrating spontaneous formation of different structures, such as vesicles, micelles, and multi-lamellar structures, depending on thermodynamical conditions.

  • 32.
    Lyubartsev, Alexander P.
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Naomé, Aymeric
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). University of Namur, Belgium .
    Vercauteren, Daniel P.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab).
    Systematic hierarchical coarse-graining with the inverse Monte Carlo method2015In: Journal of Chemical Physics, ISSN 0021-9606, E-ISSN 1089-7690, Vol. 143, no 24, article id 243120Article in journal (Refereed)
    Abstract [en]

    We outline our coarse-graining strategy for linking micro-and mesoscales of soft matter and biological systems. The method is based on effective pairwise interaction potentials obtained in detailed ab initio or classical atomistic Molecular Dynamics (MD) simulations, which can be used in simulations at less accurate level after scaling up the size. The effective potentials are obtained by applying the inverse Monte Carlo (IMC) method [A. P. Lyubartsev and A. Laaksonen, Phys. Rev. E 52(4), 3730-3737 (1995)] on a chosen subset of degrees of freedom described in terms of radial distribution functions. An in-house software package MagiC is developed to obtain the effective potentials for arbitrary molecular systems. In this work we compute effective potentials to model DNA-protein interactions (bacterial LiaR regulator bound to a 26 base pairs DNA fragment) at physiological salt concentration at a coarse-grained (CG) level. Normally the IMC CG pair-potentials are used directly as look-up tables but here we have fitted them to five Gaussians and a repulsive wall. Results show stable association between DNA and the model protein as well as similar position fluctuation profile.

  • 33.
    Lyubartsev, Alexander
    et al.
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Tu, Yaoquan
    Örebro university.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Physical, Inorganic and Structural Chemistry.
    Hierarchical Multiscale Modelling Scheme from First Principles to Mesoscale2009In: Journal of computational and theoretical nanoscience, ISSN 1546-1963 (eISSN), Vol. 6, no 5, p. 951-959Article in journal (Refereed)
    Abstract [en]

    We present a straight-forward implementation of a practical hierarchical multiscale modelling scheme which enables us to start from first-principles atomistic computer simulation and successively coarse-grain the model by leaving out uninteresting degrees of freedom. Using the Car-Parrinello method or our recently developed highly efficient tight-binding-like approximate density-functional quantum mechanical method, we first perform ab initio simulations. From these first-principles simulations we obtain a set of atomistic pair-wise effective interaction potentials to be used as a force field with no empirical data for subsequent classical all-atom simulations while scaling up the system size 2-3 orders of magnitude. The atomistic simulations similarly provide a new set of effective potentials but at a chosen coarse-grain level suitable for large-scale mesoscopic or soft-matter simulations beyond the atomic resolution. Several examples are shown of how this scheme is done based on effective interaction potentials to tie together the various scales of modelling.

  • 34. Ma, Chunyan
    et al.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Nanjing Tech University, China; Uppsala University, Sweden; Petru Poni Institute of Macromolecular Chemistry, Romania.
    Liu, Chang
    Lu, Xiaohua
    Ji, Xiaoyan
    The peculiar effect of water on ionic liquids and deep eutectic solvents2018In: Chemical Society Reviews, ISSN 0306-0012, E-ISSN 1460-4744, Vol. 47, no 23, p. 8685-8720Article, review/survey (Refereed)
    Abstract [en]

    Ionic liquids (ILs) and deep eutectic solvents (DESs) have been suggested as eco-friendly alternatives to organic solvents. A trace amount of water is often unavoidable as impurity, and water is also added on purpose to reduce their problematically high viscosity and lower their high price. Understanding the distinct effects of water on the properties of ILs/DESs is highly important. In this review, we collect published experimental and theoretical results for IL/DES-H2O systems at varied water concentrations and analyze them. Results from mechanistic studies, thermodynamic modelling and advanced experiments are collected and critically discussed. Six commonly studied IL/DES-H2O systems were selected to map experimental observations onto microscopic results obtained in mechanistic studies. A great variety of distinct contours of the excess properties can be observed over the entire compositional range, indicating that the properties of IL/DES-H2O systems are highly unpredictable. Mechanistic studies clearly demonstrate that the added H2O rapidly changes the heterogeneous 3D structures of pure ILs/DESs, leading to very different properties and behaviour. There are similarities between aqueous electrolytes and IL/DES solutions but the bulky and asymmetric organic cations in ILs/DESs do not conform to the standard salt dissolution and hydration concepts. Thermodynamic modelling previously assumes ILs/DESs to be either a neutral ion-pair or completely dissociated ions, neglecting specific ion hydration effects. A new conceptual framework is suggested for thermodynamic modelling of IL/DES-H2O binary systems to enable new technologies for their practical applications.

  • 35.
    Mace, Amber
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Hedin, Niklas
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Role of Ion Mobility in Molecular Sieving of CO2 over N-2 with Zeolite NaKA2013In: The Journal of Physical Chemistry C, ISSN 1932-7447, E-ISSN 1932-7455, Vol. 117, no 46, p. 24259-24267Article in journal (Refereed)
    Abstract [en]

    Classical molecular dynamics and Grand Canonical Monte Carlo simulations are carried out for sorbates (CO2 and N-2) in zeolite NaKA using a universal type ab initio force field. By combining the results of these simulations, we reproduce the CO2 uptake as a function of the K+ content in the zeolite NaKA as measured experimentally by Liu et al.(1) The experiment yielded an exceptionally high CO2-over-N-2 selectivity of >200 at a specific K+/(K+ + Na+) ratio of 17 atom %. This high selectivity could be attributed to the nonlinear uptake dependency of the K+/(K+ + Na+) ratio measured for both CO2 and N-2. Additionally, our simulations show a strong coupling between the self-diffusion of CO2 and the site-to-site jumping rate of the extra-framework cations. These results show that this nonlinear uptake dependency of CO2 is the result of molecular sieving. Following this, our simulations conclude that contributions must be taken into account when modeling the uptake of this and similar materials both thermodynamic and kinetic with the same functionalities.

  • 36.
    Mace, Amber
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Leetmaa, Mikael
    Uppsala universitet, Institutionen för fysik och astronomi.
    Temporal coarse graining of CO2 and N2 diffusion in Zeolite NaKA; from the quantum scale to the macroscopicManuscript (preprint) (Other academic)
    Abstract [en]

    The kinetic CO2-over-N2 sieving capabilities in narrow pore zeolite are dependent on the free energy barriers of diffusion between the zeolite pores, which can be fine-tuned by altering the framework composition. An ab initio level of theory is necessary to accurately compute the energy barriers, while it is desirable to predict the macroscopic scale diffusion for industrial applications. Using spatially constrained ab initio molecu- lar dynamics on the ps time scale, the free energy barriers of diffusion can be predicted for different local pore properties in order to identify those that are rate determining for the pore-to-pore diffusion. Specifically, we investigate the effects of the Na+-to-K+ exchange at the different cation sites and the CO2 loading. These computed energy barriers are then used as input for the Kinetic Monte Carlo method, coarse-graining the dynamic simulation steps to the pore-to-pore diffusion. With this approach we simulate how the identified rate determining properties as well as the application of skin layer surface defects affect the diffusion driven uptake in a realistic powder particle model on a macroscopic time scale. Finally, we suggest a model by combining these effects, which provides an excellent agreement with the experimental CO2 and N2 uptake behaviors presented by Liu et al.

  • 37.
    Mace, Amber
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laasonen, Kari
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Free energy barriers for CO2 and N-2 in zeolite NaKA: an ab initio molecular dynamics approach2014In: Physical Chemistry, Chemical Physics - PCCP, ISSN 1463-9076, E-ISSN 1463-9084, Vol. 16, no 1, p. 166-172Article in journal (Refereed)
    Abstract [en]

    Ab initio Molecular Dynamics (AIMD) is used with spatial constraints to estimate the free energy barriers of diffusion for CO2 and N-2 gas molecules in zeolite NaA and KA. We investigate the extent to which the diffusion of these gas molecules is hindered, in the two separate cases of a smaller Na+ ion or a larger K+ ion blocking the 8-ring pore window. In contrast to classical Molecular Dynamics, AIMD performs these computations accurately and unbiased in the absence of empirical parameterization. Our work has resulted in stable and reliable force profiles. The profiles show that the larger K+ ion effectively blocks the passage of both CO2 and N-2 molecules while the smaller Na+ ion will allow both molecules to pass. These results are a quantitative demonstration of the concept of pore blocking where we compute the effect, which the size of the respective cation occupying the pore window has on diffusive properties of each gas molecule. Hence, this effect can be altered through ion exchange to fine-tune the functionality of a specific zeolite as a molecular sieve.

  • 38.
    Mace, Amber
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Leetmaa, Mikael
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Temporal Coarse Graining of CO2 and N-2 Diffusion in Zeolite NaKA: From the Quantum Scale to the Macroscopic2015In: Journal of Chemical Theory and Computation, ISSN 1549-9618, E-ISSN 1549-9626, Vol. 11, no 10, p. 4850-4860Article in journal (Refereed)
    Abstract [en]

    The kinetic CO2-over-N-2 sieving capabilities in narrow pore zeolites are dependent on the free-energy barriers of diffusion between the zeolite pores, which can be fine-tuned by altering the framework composition. An ab initio level of theory is necessary to accurately compute the energy barriers, whereas it is desirable to predict the macroscopic scale diffusion for industrial applications. Using ab initio molecular dynamics on the picosecond time scale, the free-energy barriers of diffusion can be predicted for different local pore properties in order to identify those that are rate-determining for the pore-to-pore diffusion. Specifically, we investigate the effects of the Na+-to-K+ exchange at the different cation sites and the CO, loading in Zeolite NaKA. These computed energy barriers are then used as input for the Kinetic Monte Carlo method, coarse graining the dynamic simulation steps to the pore-to-pore diffusion. With this approach, we simulate how the identified rate-determining properties as well as the application of skin-layer surface defects affect the diffusion driven uptake in a realistic Zeolite NaKA powder particle model on a macroscopic time scale. Lastly, we suggest a model by combining these effects, which provides an excellent agreement with the experimental CO2 and N-2 uptake behaviors presented by Liu et Commun. 2010, 46, 4502-4504.

  • 39.
    Metere, Alfredo
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Oppelstrup, Tomas
    Sarman, Sten
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Dzugutov, Mikhail
    Formation of the smectic-B crystal from a simple monatomic liquid2013In: Physical Review E. Statistical, Nonlinear, and Soft Matter Physics, ISSN 1539-3755, E-ISSN 1550-2376, Vol. 88, no 6, article id 062502Article in journal (Refereed)
    Abstract [en]

    We report a molecular dynamics simulation demonstrating that the smectic-B crystalline phase (Cry-B), commonly observed in mesogenic systems of anisotropic molecules, can be formed by a system of identical particles interacting via a spherically symmetric potential. The Cry-B phase forms as a result of a first-order transition from an isotropic liquid phase upon isochoric cooling at appropriate number density. Its structure, determined by the design of the pair potential, corresponds to the Cry-B structure formed by elongated particles with the aspect ratio 1.8. The diffraction pattern and the real-space structure inspection demonstrate dominance of the ABC-type of axial layer stacking. This result opens a general possibility of producing smectic phases using isotropic interparticle interaction both in simulations and in colloidal systems.

  • 40.
    Mocci, Francesca
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). University of Cagliari, Italy.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). Stellenbosch University, South Africa.
    Combining MD simulations and NMR spectroscopy for molecular insight and methodological synergy: the integrated MD-NMR method2015In: Nuclear Magnetic Resonance: A Specialist Periodical Report / [ed] K. Kamienska Trela, Royal Society of Chemistry, 2015, Vol. 44, p. 592-616Chapter in book (Refereed)
    Abstract [en]

    NMR spectroscopy and MD simulations are highly complementary techniques to study molecular structures, interactions and dynamics. MD simulations are currently reaching the millisecond timescales covering a great variety of dynamical processes. Faster computers and new efficient sampling techniques allow calculations of NMR averages for a more reliable comparison with experiment, while new generations of force fields give better and better agreement between simulated and measured quantities. We review in this Chapter studies where close combination of these two techniques is the method itself to obtain the results and draw conclusions on the dynamics of bio, organic and inorganic systems.

  • 41.
    Mocci, Francesca
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Applied Environmental Science (ITM).
    Insight into nucleic acid counterion interactions from inside molecular dynamics simulations is worth its salt2012In: Soft Matter, ISSN 1744-683X, E-ISSN 1744-6848, Vol. 8, no 36, p. 9268-9284Article, review/survey (Refereed)
    Abstract [en]

    Nucleic acids are highly charged polyelectrolytes. Their interactions with counterions are of great importance for their structural stability, conformational behaviour and biological functions. Molecular modelling and simulation techniques, particularly molecular dynamics, have been highly useful for studies of interactions between DNA, water and ions at the molecular level, allowing us to explain many experimental observations, or to obtain information not accessible experimentally. In this review we focus on both atomistic and coarse-grained molecular simulation studies concerning the interactions of DNA with different types of counterions, with emphasis on recent studies, still open questions, limits of the method and possible further developments.

  • 42.
    Naome, Aymeric
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). University of Namur, Belgium.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). Stellenbosch University, South Africa.
    Vercauteren, Daniel P.
    A Coarse-Grained Simulation Study of the Structures, Energetics, and Dynamics of Linear and Circular DNA with Its Ions2015In: Journal of Chemical Theory and Computation, ISSN 1549-9618, E-ISSN 1549-9626, Vol. 11, no 6, p. 2813-2826Article in journal (Refereed)
    Abstract [en]

    We have studied the structural, energetics, and dynamical properties of a variety of linear and circular DNA fragments using a solvent-mediated coarse-grained (CG) model of DNA with explicit ions recently developed by us [Naome et al., J. Chem. Theory Comput., 2014, 10, 3541-3549]. We particularly examined the treatment of electrostatics and determined that a large cutoff is necessary to properly reproduce the DNA flexibility. Moreover, it is crucial to include long-ranged electrostatic interactions: a Particle Mesh Ewald scheme at low resolution is sufficient to avoid structural artifacts. We calculated the ring closure probabilities, as a j-factors, for DNA fragments of different lengths from equilibrium, as well. as restrained molecular dynamics (MD) simulations. The latter force integration method provided accurate results without model fitting. We generated topology and energy maps for DNA minicircles of various lengths and helical densities, at low and high ion concentrations. A general trend for structure compaction is observed, driven by an increase in writhing as the ionic concentration increases. Finally, we applied a reconstruction procedure to generate detailed molecular structures from the various superhelical conformations generated by the CG MD of the DNA minicircles. These pre-equilibrated reconstructed atomistic structures can serve as starting material for atomistic simulations.

  • 43.
    Naomé, Aymeric
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). University of Namur, Belgium.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). Stellenbosch University, South Africa.
    Vercauteren, Daniel P.
    A Solvent-Mediated Coarse-Grained Model of DNA Derived with the Systematic Newton Inversion Method2014In: Journal of Chemical Theory and Computation, ISSN 1549-9618, E-ISSN 1549-9626, Vol. 10, no 8, p. 3541-3549Article in journal (Refereed)
    Abstract [en]

    We present a new class of coarse-grained (CG) force fields (FFs) for B-DNA with explicit ions suited for large-scale mesoscale simulations at microsecond micrometer scale using a wide spectrum of particle simulation methods from molecular dynamics to dissipative particle dynamics. The effective solvent-mediated pairwise interactions making up the FFs are obtained by inverting radial distribution functions and other particle particle distributions obtained from all-atom simulations of numbers of octadecamer DNA fragments from the Ascona B-DNA library. The inverse Monte Carlo (IMC) method, later known as Newton inversion (NI) (Lyubartsev, A. P.; Laaksonen, A. Phys. Rev. E, 1995, 52, 3730-3737), was used together with the iterative Boltzmann inversion (IBI) scheme to compute the effective CG potentials. We show that this systematic structure-based approach is capable of providing converged potentials that accurately reproduce the structural features of the underlying atomistic system within a few percents of relative difference. We also show that a simple one-site-per-nucleotide model with 10 intramolecular pair interaction potentials is able to reproduce key features of DNA, for example, the persistence length and its dependence on the ionic concentration, experimentally determined around 50 nm at physiological salt concentration.

  • 44.
    Naomé, Aymeric
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Schyman, Patric
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Vercauteren, Daniel P.
    Molecular Dynamics Simulation of 8-Oxoguanine Containing DNA Fragments Reveals Altered Hydration and Ion Binding Patterns2010In: Journal of Physical Chemistry B, ISSN 1520-6106, E-ISSN 1520-5207, Vol. 114, no 14, p. 4789-4801Article in journal (Refereed)
    Abstract [en]

    We present results of molecular dynamics (MD) simulations of a double-stranded DNA fragment of sequence 5'-d(CGCGAGTTCGCG)-3' and 3'-d(GCGCTCAAGCGC)-5' in its native form and altered with guanine in the G6/C19 base pair replaced by 8-oxoguanine (8oxoG). DNA was simulated in solution with Na+ counterions and explicit water molecules. Trajectories were analyzed for radial distribution functions (RDFs), spatial distribution functions (SDFs), residence times, and occupancies, for both water and ions. Structural parameters of DNA fragments were also considered. Particularly, we report sensible differences in the statistical and dynamical behavior of water and ions between the healthy and lesion containing models. Structural features such as sugar phosphate backbone torsion angles also significantly differ. We conclude that 8oxoG noticeably modifies its close environment and that the observed changes in the vicinity of the lesion site might help the enzymes in charge of cleansing 8oxoG from human DNA to locate the aberration in its intrahelical context. This work supports the existence of a determinant early recognition mode of 8oxoG; for hOGG1.

  • 45.
    Pei, Han-Wen
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). KTH Royal Institute of Technology, Sweden.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Nanjing Tech University, China; Petru Poni Institute of Macromolecular Chemistry, Romania.
    Feature vector clustering molecular pairs in computer simulationsIn: Journal of Computational Chemistry, ISSN 0192-8651, E-ISSN 1096-987XArticle in journal (Refereed)
    Abstract [en]

    A clustering framework is introduced to analyze the microscopic structural organization of molecular pairs in liquids and solutions. A molecular pair is represented by a representative vector (RV). To obtain RV, intermolecular atom distances in the pair are extracted from simulation trajectory as components of the key feature vector (KFV). A specific scheme is then suggested to transform KFV to RV by removing the influence of permutational molecular symmetry on the KFV as the predicted clusters should be independent of possible permutations of identical atoms in the pair. After RVs of pairs are obtained, a clustering analysis technique is finally used to classify all the RVs of molecular pairs into the clusters. The framework is applied to analyze trajectory from molecular dynamics simulations of an ionic liquid (trihexyltetradecylphosphonium bis(oxalato)borate ([P-6,P-6,P-6,P-14][BOB])). The molecular pairs are successfully categorized into physically meaningful clusters, and their effectiveness is evaluated by computing the product moment correlation coefficient (PMCC). (Willett, Winterman, and Bawden, J. Chem. Inf. Comput. Sci. 1986, 26, 109-118; Downs, Willett, and Fisanick, J. Chem. Inf. Comput. Sci. 1994, 34, 1094-1102) It is observed that representative configurations of two clusters are related to two energy local minimum structures optimized by density functional theory (DFT) calculation, respectively. Several widely used clustering analysis techniques of both nonhierarchical (k-means) and hierarchical clustering algorithms are also evaluated and compared with each other. The proposed KFV technique efficiently reveals local molecular pair structures in the simulated complex liquid. It is a method, which is highly useful for liquids and solutions in particular with strong intermolecular interactions. 

  • 46. Perepelytsya, Sergiy
    et al.
    Uličný, Jozef
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Nanjing Tech University, China; Petru Poni Institute of Macromolecular Chemistry, Romania.
    Mocci, Francesca
    Pattern preferences of DNA nucleotide motifs by polyamines putrescine(2+), spermidine(3+)and spermine(4+)2019In: Nucleic Acids Research, ISSN 0305-1048, E-ISSN 1362-4962, Vol. 47, no 12, p. 6084-6097Article in journal (Refereed)
    Abstract [en]

    The interactions of natural polyamines (putrescine(2+), spermidine(3+)and spermine(4+)) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine(2+), spermidine(3+)and spermine(4+) in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

  • 47.
    Rebic, Matus
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). P. J. Šafárik University, Slovakia.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). Wallenberg Research Centre at Stellenbosch University, South Africa; University of Cagliari, Italy.
    Sponer, Jiri
    Ulicny, Jozef
    Mocci, Francesca
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). University of Cagliari, Italy.
    Molecular Dynamics Simulation Study of Parallel Telomeric DNA Quadruplexes at Different Ionic Strengths: Evaluation of Water and Ion Models2016In: Journal of Physical Chemistry B, ISSN 1520-6106, E-ISSN 1520-5207, Vol. 120, no 30, p. 7380-7391Article in journal (Refereed)
    Abstract [en]

    Most molecular dynamics (MD) simulations of DNA quadruplexes have been performed under minimal salt conditions using the Aqvist potential parameters for the cation with the TIP3P water model. Recently, this combination of parameters has been reported to be problematic for the stability of quadruplex DNA, especially caused by the ion interactions inside or near the quadruplex channel. Here, we verify how the choice of ion parameters and water model can affect the quadruplex structural stability and the interactions with the ions outside the channel. We have performed a series of MD simulations of the human full-parallel telomeric quadruplex by neutralizing its negative charge with K+ ions. Three combinations of different cation potential parameters and water models have been used: (a) Aqvist ion parameters, TIP3P water model; (b) Joung and Cheatham ion parameters, TIP3P water model; and (c) Joung and Cheatham ion parameters, TTP4P(ew) water model. For the combinations (b) and (c), the effect of the ionic strength has been evaluated by adding increasing amounts of KCl salt (50, 100, and 200 mM). Two independent simulations using the Aqvist parameters with the TIP3P model show that this combination is clearly less suited for the studied quadruplex with K+ counterions. In both simulations, one ion escapes from the channel, followed by significant deformation of the structure, leading to deviating conformation compared to that in the reference crystallographic data. For the other combinations of ion and water potentials, no tendency is observed for the channel ions to escape from the quadruplex channel. In addition, the internal mobility of the three loops, torsion angles, and counterion affinity have been investigated at varied salt concentrations. In summary, the selection of ion and water models is crucial as it can affect both the structure and dynamics as well as the interactions of the quadruplex with its counterions. The results obtained with the TIP4P(ew) model are found to be closest to the experimental data at all of the studied ion concentrations.

  • 48. Rebic, Matus
    et al.
    Mocci, Francesca
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). University of Cagliari, Italy.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stellenbosch University, South Africa.
    Ulicny, Jozef
    Multiscale Simulations of Human Telomeric G-Quadruplex DNA2015In: Journal of Physical Chemistry B, ISSN 1520-6106, E-ISSN 1520-5207, Vol. 119, no 1, p. 105-113Article in journal (Refereed)
    Abstract [en]

    We present a coarse-grain (CG) model of human telomeric G-quadruplex, obtained using the inverse Monte Carlo (IMC) and iterative Boltzmann inversion (IBI) techniques implemented within the software package called MagiC. As a starting point, the 2HY9 human telomeric [3 + 1] hybrid, a 26-nucleobase sequence, was modeled performing a 1 mu s long atomistic molecular dynamics (MD) simulation. The chosen quadruplex includes two kinds of loops and all possible combinations of relative orientations of guanine strands that can be found in quadruplexes. The effective CG potential for a one bead per nucleotide model has been developed from the radial distribution functions of this reference system. The obtained potentials take into account explicitly the interaction with counterions, while the effect of the solvent is included implicitly. The structural properties of the obtained CG model of the quadruplex provided a perfect match to those resulting from the reference atomistic MD simulation. The same set of interaction potentials was then used to simulate at the CG level another quadruplex topology (PDB id 1KF1) that can be formed by the human telomeric DNA sequence. This quadruplex differs from 2HY9 in the loop topology and G-strand relative orientation. The results of the CG MD simulations of 1KF1 are very encouraging and suggest that the CG model based on 2HY9 can be used to simulate quadruplexes with different topologies. The CG model was further applied to a higher order human telomeric quadruplex formed by the repetition, 20 times, of the 1KF1 quadruplex structure. In all cases, the developed model, which to the best of our knowledge is the first model of quadruplexes at the CG level presented in the literature, reproduces the main structural features remarkably well.

  • 49.
    Rebič, Matúš
    et al.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). P. J. Šafárik University, Slovakia.
    Mocci, Francesca
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). University of Cagliari, Italy.
    Uličný, Jozef
    Lyubartsev, Alexander P.
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). University of Cagliari, Italy.
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK). Stockholm University, Science for Life Laboratory (SciLifeLab). University of Cagliari, Italy; Stellenbosch University, South Africa.
    Coarse-Grained Simulation of Rodlike Higher-Order Quadruplex Structures at Different Salt Concentrations2017In: ACS Omega, ISSN 2470-1343, Vol. 2, no 2, p. 386-396Article in journal (Refereed)
    Abstract [en]

    We present a coarse-grained (CG) model of a rodlike higher-order quadruplex with explicit monovalent salts, which was developed from radial distribution functions of an underlying reference atomistic molecular dynamics simulation using inverse Monte Carlo technique. This work improves our previous CG model and extends its applicability beyond the minimal salt conditions, allowing its use at variable ionic strengths. The strategies necessary for the model development are clearly explained and discussed. The effects of the number of stacked quadruplexes and varied salt concentration on the elasticity of the rodlike higher-order quadruplex structures are analyzed. The CG model reproduces the deformations of the terminal parts in agreement with experimental observations without introducing any special parameters for terminal beads and reveals slight differences in the rise and twist of the G-quartet arrangement along the studied biopolymer. The conclusions of our study can be generalized for other G-quartet-based structures.

  • 50.
    Rios, Ramón
    et al.
    Stockholm University, Faculty of Science, Department of Organic Chemistry.
    Schyman, Patric
    Sundén, Henrik
    Stockholm University, Faculty of Science, Department of Organic Chemistry.
    Zhao, Gui-Ling
    Stockholm University, Faculty of Science, Department of Organic Chemistry.
    Ullah, Farman
    Stockholm University, Faculty of Science, Department of Organic Chemistry.
    Chen, Li-Jun
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Laaksonen, Aatto
    Stockholm University, Faculty of Science, Department of Materials and Environmental Chemistry (MMK).
    Córdova, Armando
    Stockholm University, Faculty of Science, Department of Organic Chemistry.
    Nonlinear effects in asymmetric amino acid catalysis by multiple interconnected stereoselective catalytic networks2010In: Chemistry - A European Journal, ISSN 0947-6539, E-ISSN 1521-3765, Vol. 16, no 47, p. 13935-13940Article in journal (Refereed)
12 1 - 50 of 92
CiteExportLink to result list
Permanent link
Citation style
  • apa
  • ieee
  • modern-language-association-8th-edition
  • vancouver
  • Other style
More styles
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf